ID: 1183254081

View in Genome Browser
Species Human (GRCh38)
Location 22:36749635-36749657
Sequence CTCCAACAGCACAGGCTGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183254076_1183254081 -10 Left 1183254076 22:36749622-36749644 CCCAAGAGGGAACCTCCAACAGC No data
Right 1183254081 22:36749635-36749657 CTCCAACAGCACAGGCTGTAGGG No data
1183254075_1183254081 -7 Left 1183254075 22:36749619-36749641 CCACCCAAGAGGGAACCTCCAAC No data
Right 1183254081 22:36749635-36749657 CTCCAACAGCACAGGCTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183254081 Original CRISPR CTCCAACAGCACAGGCTGTA GGG Intergenic
No off target data available for this crispr