ID: 1183254656

View in Genome Browser
Species Human (GRCh38)
Location 22:36754546-36754568
Sequence CATCAGTGACCCCTCAGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183254656_1183254658 -4 Left 1183254656 22:36754546-36754568 CCACCTCTGAGGGGTCACTGATG No data
Right 1183254658 22:36754565-36754587 GATGAGCCAATGATGCCTAGAGG No data
1183254656_1183254659 -3 Left 1183254656 22:36754546-36754568 CCACCTCTGAGGGGTCACTGATG No data
Right 1183254659 22:36754566-36754588 ATGAGCCAATGATGCCTAGAGGG No data
1183254656_1183254661 4 Left 1183254656 22:36754546-36754568 CCACCTCTGAGGGGTCACTGATG No data
Right 1183254661 22:36754573-36754595 AATGATGCCTAGAGGGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183254656 Original CRISPR CATCAGTGACCCCTCAGAGG TGG (reversed) Intergenic
No off target data available for this crispr