ID: 1183254661

View in Genome Browser
Species Human (GRCh38)
Location 22:36754573-36754595
Sequence AATGATGCCTAGAGGGTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183254657_1183254661 1 Left 1183254657 22:36754549-36754571 CCTCTGAGGGGTCACTGATGAGC No data
Right 1183254661 22:36754573-36754595 AATGATGCCTAGAGGGTGCCAGG No data
1183254656_1183254661 4 Left 1183254656 22:36754546-36754568 CCACCTCTGAGGGGTCACTGATG No data
Right 1183254661 22:36754573-36754595 AATGATGCCTAGAGGGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183254661 Original CRISPR AATGATGCCTAGAGGGTGCC AGG Intergenic
No off target data available for this crispr