ID: 1183256790

View in Genome Browser
Species Human (GRCh38)
Location 22:36767453-36767475
Sequence GAGGGCTATCTCCAGTGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 89}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183256775_1183256790 28 Left 1183256775 22:36767402-36767424 CCCCAAAGGGAGAGCATGTTACA 0: 1
1: 0
2: 0
3: 15
4: 198
Right 1183256790 22:36767453-36767475 GAGGGCTATCTCCAGTGGAAGGG 0: 1
1: 0
2: 0
3: 3
4: 89
1183256774_1183256790 29 Left 1183256774 22:36767401-36767423 CCCCCAAAGGGAGAGCATGTTAC 0: 1
1: 0
2: 2
3: 7
4: 98
Right 1183256790 22:36767453-36767475 GAGGGCTATCTCCAGTGGAAGGG 0: 1
1: 0
2: 0
3: 3
4: 89
1183256776_1183256790 27 Left 1183256776 22:36767403-36767425 CCCAAAGGGAGAGCATGTTACAG 0: 1
1: 0
2: 2
3: 10
4: 149
Right 1183256790 22:36767453-36767475 GAGGGCTATCTCCAGTGGAAGGG 0: 1
1: 0
2: 0
3: 3
4: 89
1183256777_1183256790 26 Left 1183256777 22:36767404-36767426 CCAAAGGGAGAGCATGTTACAGG 0: 1
1: 0
2: 1
3: 14
4: 119
Right 1183256790 22:36767453-36767475 GAGGGCTATCTCCAGTGGAAGGG 0: 1
1: 0
2: 0
3: 3
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183256790 Original CRISPR GAGGGCTATCTCCAGTGGAA GGG Intronic
902251579 1:15156994-15157016 GAGGGCTCAATCCAGAGGAAGGG - Intronic
904645710 1:31964569-31964591 GAGTGCTCTCTCTAGTGGACAGG - Intergenic
905411293 1:37770495-37770517 GGGGACTATCTGGAGTGGAAAGG - Intergenic
906110670 1:43319937-43319959 GAGGGCTGTCTGCAGGGGAGGGG - Intronic
906929501 1:50155357-50155379 GAGGCCTGTCTCCAGAGAAAGGG - Intronic
907914216 1:58853746-58853768 GAGGGCTATCTCCTGTTGAGTGG + Intergenic
915243503 1:154540748-154540770 CAAGGCCATCTCCAGTGCAACGG - Intronic
916081557 1:161236426-161236448 GAGGGCTATTTCCATTGGGGAGG + Intronic
916401365 1:164452397-164452419 GAGGGCTATCTTCTCAGGAAGGG + Intergenic
920527270 1:206676476-206676498 CAAGGCTATCCCCATTGGAATGG - Intronic
922382123 1:225040595-225040617 GATGTCTATCAACAGTGGAATGG - Intronic
1064603737 10:17017496-17017518 GAGGGCCATATCCTGAGGAAGGG + Intronic
1065162840 10:22940949-22940971 GAGGTCTATCAACAGTTGAATGG + Intronic
1074362573 10:112834930-112834952 AAGGGCTCTCTCAAGTGGCAGGG - Intergenic
1074547142 10:114409763-114409785 GAGGACTGTCTGCATTGGAATGG - Intergenic
1075146172 10:119884875-119884897 GAGGGCTATACCCTGAGGAAAGG - Intronic
1075949550 10:126464864-126464886 GAGAGCTATCCCCAATGGGAAGG + Exonic
1083225317 11:61281116-61281138 GAGGGCTATGTCCTGGGGACAGG + Exonic
1089256625 11:117197669-117197691 GAGGGATGTCTGCAGTGGGATGG - Intergenic
1090273242 11:125402388-125402410 GAGGTGTCTCTCTAGTGGAATGG - Intronic
1091699311 12:2649621-2649643 GAGGGCTCTGAACAGTGGAATGG + Intronic
1092982540 12:13811098-13811120 GAGGCCTAACTTCAGTGAAATGG + Intronic
1093135399 12:15444085-15444107 GGGGCCTATCAGCAGTGGAATGG + Intronic
1097769153 12:63560601-63560623 GAGGGTTAGCTGCATTGGAAGGG + Exonic
1102694747 12:114790049-114790071 ATGGGTTATCTCCAGGGGAAGGG + Intergenic
1104416541 12:128600528-128600550 GATGGCTTTCTCAAGTGGAGTGG + Intronic
1108249373 13:48549669-48549691 GAAGCCTGTCTTCAGTGGAAAGG + Intergenic
1108905891 13:55472285-55472307 GGGGGCTATCAACAGTAGAATGG + Intergenic
1109456207 13:62593717-62593739 GAGGGCTATGTCCAATAAAAGGG + Intergenic
1119312774 14:73663774-73663796 GAAAGCTCTCTGCAGTGGAAAGG + Intronic
1120213858 14:81661065-81661087 AAGGACTATATCCTGTGGAATGG + Intergenic
1129104513 15:73296811-73296833 GAGGCACATCCCCAGTGGAATGG + Intronic
1131328185 15:91469172-91469194 GAGAGCTGCCCCCAGTGGAAGGG - Intergenic
1139898603 16:70309065-70309087 GTCGGCTTTCTCCAGTTGAATGG + Intronic
1144344319 17:14336335-14336357 GAGGGATATCACCCGAGGAAAGG + Intronic
1149065938 17:52479313-52479335 GAGGGCTGGCTTCATTGGAAGGG + Intergenic
1157290049 18:46403363-46403385 GAGGGCTCTCTCCGGGGGCAGGG - Intronic
1163244992 19:16087951-16087973 GGGGGCTGTCTGCAGTGGATGGG + Intronic
927895555 2:26779466-26779488 GAGGGGTATTTCCAGTGGATGGG - Exonic
927909945 2:26890288-26890310 CAGAGTTGTCTCCAGTGGAAAGG + Intronic
930056981 2:47259711-47259733 GAGTGGGATCTCTAGTGGAAAGG + Intergenic
930486713 2:52019400-52019422 GATGCCTATCAACAGTGGAATGG + Intergenic
931333944 2:61320308-61320330 GAGGGCAATCTGCAATGGAATGG - Intronic
931898114 2:66756415-66756437 CAGTGCTATCCCCAGTGGTAGGG + Intergenic
932695311 2:73951360-73951382 CAAGGATCTCTCCAGTGGAAAGG - Intronic
932975934 2:76599691-76599713 GAGGGGTATGTCTACTGGAAAGG - Intergenic
936488430 2:112947422-112947444 GAAGGCTCTCTGCAGTGGAGAGG - Intergenic
946537087 2:220642737-220642759 GAAGGCTACCTCCAGTATAACGG + Intergenic
948679182 2:239620808-239620830 GATGGTTACCTCCAGGGGAAGGG - Intergenic
1175795800 20:61769951-61769973 GTGGGATGTCTTCAGTGGAAGGG + Intronic
1178679434 21:34660134-34660156 CAGGGCAATCTCCAGGGGCAGGG - Intergenic
1181102283 22:20549538-20549560 CAGGGCTTTCTCCCCTGGAAAGG + Intronic
1182014393 22:27026814-27026836 GAAGGCATCCTCCAGTGGAAGGG + Intergenic
1183256790 22:36767453-36767475 GAGGGCTATCTCCAGTGGAAGGG + Intronic
950776545 3:15355319-15355341 GAGGAGGAACTCCAGTGGAAAGG + Intergenic
953770457 3:45775641-45775663 GAGTGCCCTCTGCAGTGGAAAGG - Intronic
956103852 3:65796290-65796312 GAGGCCAATCCCCATTGGAAAGG + Intronic
963034728 3:141015988-141016010 GAGCCCTCTCTCCACTGGAATGG - Intergenic
971621802 4:28863825-28863847 GGGGGCAAACTCCACTGGAAAGG - Intergenic
973610856 4:52634958-52634980 GAGGGGTAGCTGAAGTGGAATGG - Intronic
978602289 4:110441391-110441413 GAGGACTATCTTCAGTTGTATGG - Intronic
984898532 4:184563903-184563925 CAGGGCTATCTACAATGAAAGGG - Intergenic
986101153 5:4612920-4612942 GAGGGCTACCTCCAGGGAGATGG + Intergenic
999932977 5:156454139-156454161 GAAGGATATCTGCATTGGAAAGG + Intronic
1002357241 5:178640913-178640935 AAGGGCTTACTGCAGTGGAAGGG - Intergenic
1002602774 5:180363436-180363458 GGGTGCTATCCCCAGTGGAGAGG - Intergenic
1007718199 6:43869546-43869568 GAGGGATGTCCCCAGTGGACTGG + Intergenic
1008964840 6:57304500-57304522 TTGTGCTTTCTCCAGTGGAATGG - Intergenic
1012830242 6:104195396-104195418 GAGTGCTATGGCCAGTGGCATGG + Intergenic
1020265098 7:6555249-6555271 GAGATCCGTCTCCAGTGGAAAGG + Intergenic
1022245835 7:28558510-28558532 AAATGCTATCTTCAGTGGAAAGG - Intronic
1022367758 7:29742186-29742208 GAGGGTTAGCTGCATTGGAAGGG - Intergenic
1022928427 7:35081679-35081701 GAGGGTTAGCTGCATTGGAAGGG + Intergenic
1023688649 7:42763508-42763530 GAGGGCTTTCTCCGGTGCCAGGG + Intergenic
1028654858 7:93193266-93193288 GAGAGCTATAGCAAGTGGAATGG - Intronic
1029824535 7:103175350-103175372 GAGGGTTAGCTGCATTGGAAGGG + Intergenic
1030563138 7:111116190-111116212 GAGCCCTATATCCAGAGGAATGG + Intronic
1032945837 7:136851556-136851578 AAGGGCTATTTCAAGTGGAGTGG + Intergenic
1036109160 8:5878634-5878656 GAAGGCTAGCTCCAGTGCACTGG + Intergenic
1037638137 8:20719042-20719064 GAGGGCTGTCTCCTAAGGAAAGG - Intergenic
1040901076 8:52417566-52417588 TGGGACTACCTCCAGTGGAAAGG + Intronic
1043485992 8:80699941-80699963 GATGAGTAACTCCAGTGGAAAGG - Intronic
1044684371 8:94812844-94812866 GATGGCTAGCTCCAGGGAAAAGG + Intergenic
1048194091 8:132317836-132317858 GAGTGATATCTGCAATGGAAAGG + Intronic
1048457864 8:134594064-134594086 CAGAACTATTTCCAGTGGAAAGG - Intronic
1048680337 8:136833997-136834019 CAGGGCTATCTACAATGGGATGG - Intergenic
1049611734 8:143559037-143559059 GAGGGCTCTGTCCACTAGAATGG - Intronic
1058916268 9:109568754-109568776 GAGGGCTGTTGCCAGTGGACTGG + Intergenic
1059330114 9:113529599-113529621 CAGGGCGATCTCTAGAGGAAGGG - Intronic
1061941217 9:133885088-133885110 GAGGGTTCTCTCCAGAGGACTGG + Intronic
1195997051 X:110741828-110741850 GTGGCCTATCTGCAGTAGAATGG - Intronic
1200010317 X:153115419-153115441 GATGGCTATCTTGAGTAGAAGGG - Intergenic
1200029283 X:153284503-153284525 GATGGCTATCTTGAGTAGAAGGG + Intergenic