ID: 1183257242

View in Genome Browser
Species Human (GRCh38)
Location 22:36770483-36770505
Sequence TTGGATATACAGACAAAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 212}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183257242_1183257246 8 Left 1183257242 22:36770483-36770505 CCAAGCTTTGTCTGTATATCCAA 0: 1
1: 0
2: 0
3: 9
4: 212
Right 1183257246 22:36770514-36770536 GTGCGTTGCCACTAGAATGAAGG 0: 1
1: 0
2: 0
3: 3
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183257242 Original CRISPR TTGGATATACAGACAAAGCT TGG (reversed) Intronic
900285615 1:1898660-1898682 TTGGATATACACACATAAGTTGG + Intergenic
901104977 1:6748163-6748185 CTGTTTATATAGACAAAGCTTGG - Intergenic
905665242 1:39759693-39759715 TTGGAGAAACAGAAAAATCTTGG - Exonic
906807317 1:48791710-48791732 TTGGATATGGAGACAAAATTAGG + Intronic
907643125 1:56212726-56212748 ATGGAGATGAAGACAAAGCTTGG + Intergenic
909626559 1:77723426-77723448 TTGGAGATGCAGACTGAGCTAGG + Exonic
910264889 1:85328122-85328144 TTTGAAAAACAGACAAACCTTGG - Intronic
912578612 1:110699723-110699745 TTGGATATACACCCAAAAGTAGG - Intergenic
915391686 1:155549761-155549783 TTGGATATACAGTCATCCCTCGG - Intronic
915624045 1:157103733-157103755 TGGGCTAGACACACAAAGCTTGG + Intergenic
917465129 1:175269554-175269576 TTGTATATAAAGACAAATCATGG - Intergenic
918196386 1:182226217-182226239 TCGGATATACATCCAACGCTGGG + Intergenic
918634731 1:186761967-186761989 TTGGACATACAGTCAGATCTAGG - Intergenic
919028946 1:192214232-192214254 TTGAATATACAAACCAAGTTGGG - Intergenic
921695541 1:218204899-218204921 TTGGAAATACAGAAGAAGTTTGG - Intergenic
922405226 1:225305701-225305723 TAGGTTATATAGACAAGGCTTGG - Intronic
922946157 1:229515900-229515922 TTGAACATACAGACAAGCCTGGG + Intergenic
924951873 1:248892129-248892151 TTGCTTATATAGACAAAGCATGG + Intergenic
1064159863 10:12936064-12936086 TTGGATCTACATACAAAAATGGG - Intronic
1064542842 10:16422769-16422791 TTGGAGAGAAAGACAAAGCCAGG + Intergenic
1064695076 10:17956806-17956828 TTAGATAATAAGACAAAGCTGGG - Intronic
1065077515 10:22096195-22096217 TTGGATTTATAGACAAATTTGGG + Intergenic
1065765672 10:29027197-29027219 TTTGAGAGACAGAGAAAGCTGGG - Intergenic
1068104187 10:52592776-52592798 CTGGATATACAGGCATATCTTGG - Intergenic
1074793353 10:116914729-116914751 GTGGATATACAAACAAAGGCAGG + Intronic
1077717676 11:4598404-4598426 TTGGCTATTAAGACAAATCTTGG - Intergenic
1080354796 11:31430938-31430960 TTGGAAATACGGACCAAGATTGG - Exonic
1080481415 11:32654530-32654552 TTTTATATACCAACAAAGCTTGG + Intronic
1081576554 11:44322159-44322181 TTGGATTTACAGAACAAGGTTGG - Intergenic
1082211095 11:49502392-49502414 TTGGATATCAGGACAATGCTAGG - Intergenic
1084482185 11:69428416-69428438 TAGGTAATACATACAAAGCTGGG - Intergenic
1085582218 11:77663144-77663166 TTTAATATTCAGAAAAAGCTAGG - Exonic
1086303138 11:85451533-85451555 TTACATATATAAACAAAGCTTGG - Intronic
1089977837 11:122747651-122747673 TTGGAGACAGAGTCAAAGCTGGG + Intronic
1090903147 11:131050122-131050144 TTGGATGTACAGTCAAGGTTAGG - Intergenic
1095373738 12:41501453-41501475 TTGGATATACTGCAAAATCTGGG - Intronic
1097631696 12:62072077-62072099 TTGCATATCCAGAGAAAGATAGG + Intronic
1098164098 12:67675276-67675298 TTGGATATACACACATACTTGGG + Intergenic
1098806669 12:75028569-75028591 CTGGATATACAGTCAAAGAGAGG - Intergenic
1099099885 12:78425634-78425656 TTAGAGATCCAGACATAGCTTGG + Intergenic
1102011318 12:109620282-109620304 TTGGAGATGCAGACAAAATTGGG + Intergenic
1106085110 13:26534855-26534877 TTGGATAAATTTACAAAGCTGGG + Intergenic
1107742135 13:43461951-43461973 CTGGATAAACATACAAAGCTTGG + Intronic
1109675082 13:65664626-65664648 TTGAATATATACACAAAGCATGG + Intergenic
1109750723 13:66687150-66687172 TTGGACATACAAACAAAACTTGG - Intronic
1111763029 13:92489767-92489789 TTGGAGGTACAGACAGAGCTGGG + Intronic
1114879115 14:26761784-26761806 CTGCAAATACAGACTAAGCTTGG - Intergenic
1114990629 14:28283598-28283620 TTGAATATATGGATAAAGCTGGG - Intergenic
1115425173 14:33250372-33250394 ATTGATATACAGACAAGGTTTGG + Intronic
1117413390 14:55471003-55471025 TTGGACACACAGACCAATCTTGG + Intergenic
1118174632 14:63425735-63425757 TTGGATATATTAATAAAGCTGGG + Intronic
1119385312 14:74254519-74254541 TTGAATATACAGCCAAAGGCTGG + Intronic
1121487493 14:94329985-94330007 TTGGAAAAAGAGAAAAAGCTAGG + Intergenic
1121832815 14:97066470-97066492 TTGGATACACAGAGAAAGTCAGG - Intergenic
1124721860 15:32117495-32117517 TTGGATCTACAATCAAAGCAGGG - Intronic
1125772934 15:42183770-42183792 TTGGATAAAGAGACAAAACAAGG - Intronic
1129768938 15:78191025-78191047 TTAAATATAAAGACACAGCTAGG + Intronic
1130072379 15:80658614-80658636 TTGAATATACAGACAAGTTTGGG - Intergenic
1130846027 15:87746997-87747019 TTGGATAGAAAGACACTGCTTGG - Intergenic
1130876882 15:88022266-88022288 TTGGATGTACAGATAGAACTTGG - Intronic
1130902059 15:88214774-88214796 TGGTAAATTCAGACAAAGCTGGG - Intronic
1138781549 16:59794595-59794617 TTGGAGAAACTGATAAAGCTGGG + Intergenic
1149669682 17:58395328-58395350 TTGTATATACATTTAAAGCTAGG - Intronic
1149804797 17:59606203-59606225 TTGGATATACAAACTTAGCCAGG - Intronic
1150654701 17:67032163-67032185 TTGGATAAACGGACCGAGCTGGG + Exonic
1156559758 18:38110221-38110243 TTGAATCTATAGACAAATCTGGG - Intergenic
1158755148 18:60315140-60315162 ATTAATATACAGACACAGCTTGG - Intergenic
924969191 2:108796-108818 TTGGAGAGAGAGGCAAAGCTGGG + Intergenic
924971532 2:132475-132497 TGGGATAGAGAGACACAGCTGGG + Intergenic
928059682 2:28098946-28098968 TTGGATATACTAACAAGGTTAGG + Intronic
928693472 2:33824614-33824636 TTTGATAGAGAGACAAAACTAGG + Intergenic
928847848 2:35700922-35700944 TTTGAAATAAAGACTAAGCTAGG - Intergenic
928979776 2:37125645-37125667 TTGGATATCCAGCCTAAGATAGG + Intronic
929752863 2:44735224-44735246 TTAAATATACAGACACAACTAGG - Intronic
930173081 2:48271668-48271690 TTTAATATACACACATAGCTGGG + Intergenic
931965306 2:67526968-67526990 TTGAATCTACAGATAAAGTTGGG - Intergenic
932054845 2:68433313-68433335 TTGGATCTGCAGCCACAGCTTGG + Intergenic
933049250 2:77581806-77581828 TTGGATATACACACAGAAGTGGG + Intronic
935485037 2:103642985-103643007 TAGGCTATACACTCAAAGCTAGG + Intergenic
936068956 2:109352893-109352915 TTTGATTTGCAGGCAAAGCTTGG + Intronic
936120828 2:109742596-109742618 TTGGATCTACAGATTAAGTTGGG - Intergenic
936223869 2:110628877-110628899 TTGGATCTACAGATTAAGTTGGG + Intergenic
937206642 2:120240900-120240922 TTGGGTAGACAGAGAGAGCTGGG + Intronic
939874891 2:147566577-147566599 TTAGATAGAAAGACATAGCTTGG + Intergenic
940164081 2:150749314-150749336 TTAGATATAAAGACACAGATAGG - Intergenic
940405794 2:153300403-153300425 CTGGATGTACAGGGAAAGCTGGG + Intergenic
942120033 2:172767713-172767735 TTGGAGGTACACACAAAGGTAGG - Intronic
942849691 2:180469560-180469582 TTGGATATACACCCAAAACTGGG - Intergenic
945000298 2:205343284-205343306 TTGGCTATCAACACAAAGCTGGG - Intronic
945652072 2:212575171-212575193 TTGGATATATAGCCAGAGGTGGG + Intergenic
946979564 2:225194525-225194547 TTGGAAAAACAGACAAATGTGGG + Intergenic
948929370 2:241122094-241122116 TGTGATACACAGATAAAGCTGGG + Intronic
1169038830 20:2476138-2476160 TTGGGAATACAGAGAGAGCTGGG + Intronic
1169294404 20:4381299-4381321 TTCGATGTACAGACAAGGTTAGG - Intergenic
1171215420 20:23349051-23349073 TTGAATGAACAGACAAACCTGGG - Intergenic
1173381267 20:42544983-42545005 TTGGATCTAAAGGCGAAGCTGGG - Intronic
1177198505 21:17928462-17928484 TTGGATACAGAGACAAAGCGGGG + Intronic
1182824263 22:33250102-33250124 TTGAATCTACAGATAAAGTTAGG + Intronic
1183257242 22:36770483-36770505 TTGGATATACAGACAAAGCTTGG - Intronic
1184964620 22:47962138-47962160 TTGAATATACAGATGAATCTGGG - Intergenic
950625633 3:14244670-14244692 GTGGAGATACAAACAAAGGTGGG + Intergenic
950819719 3:15743395-15743417 TTGCAAATAAACACAAAGCTTGG + Intronic
951662340 3:25082930-25082952 TTGGATATACAGCTCCAGCTTGG + Intergenic
953076646 3:39577787-39577809 TTAGATATGAAGACATAGCTAGG - Intergenic
953260447 3:41333705-41333727 TAGGATATATAGACAGGGCTGGG + Intronic
955126750 3:56119847-56119869 TTGGATATCAAGACAAACCTGGG - Intronic
957180411 3:76870412-76870434 TTGGCTAAACAGAAAAAACTGGG - Intronic
960822966 3:121753734-121753756 TTGAATCTACAGATAAAGTTGGG - Intergenic
962100944 3:132341989-132342011 TTGGCTATACATATAAAACTTGG - Intronic
963763560 3:149309488-149309510 TTGGGTCTACAGACAAACTTTGG - Intergenic
964720968 3:159766626-159766648 TTGGGTATACATGCAAAGTTAGG + Intronic
965168958 3:165235780-165235802 GTGAATATACAAACAAAGTTTGG - Intergenic
966009602 3:175058357-175058379 TTGGTTATTCACACATAGCTAGG + Intronic
967440776 3:189505836-189505858 TCTAATTTACAGACAAAGCTGGG - Intergenic
968206508 3:196806964-196806986 TGAGATAAACAGAGAAAGCTTGG - Intronic
969986424 4:11216125-11216147 ATGGATAAACAGAAAGAGCTTGG - Intergenic
971611999 4:28737508-28737530 TTAGATATAAAGCCAAACCTAGG + Intergenic
971837391 4:31786161-31786183 CTGTAAATACAGATAAAGCTTGG - Intergenic
974461650 4:62196251-62196273 TTGGATTTAGAGATATAGCTAGG + Intergenic
977673776 4:99725750-99725772 TTGGATATAGACTCAAAGCCAGG - Intergenic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
978347276 4:107784955-107784977 ATGGAAATACAGAGAAAACTTGG - Intergenic
979392513 4:120143277-120143299 TTGGAAGCACAGATAAAGCTTGG - Intergenic
980842031 4:138275334-138275356 ATTGATATACAGATGAAGCTTGG - Intergenic
981134130 4:141190796-141190818 TTGGATATGGAGACAAAATTAGG + Intronic
981352015 4:143742178-143742200 TTGTATATAAAAACTAAGCTTGG - Intergenic
981791954 4:148548056-148548078 TTGGATATACATCCAAAAGTAGG - Intergenic
984643564 4:182197250-182197272 TTGCATCTACACTCAAAGCTTGG + Intronic
985443292 4:190001035-190001057 TTGGATAAACAGGCAGAGGTTGG - Intergenic
985851908 5:2394710-2394732 TTGTATCTAAAGACGAAGCTGGG + Intergenic
986342439 5:6802311-6802333 TTGGATCAACATAGAAAGCTTGG - Intergenic
988247902 5:28712410-28712432 TTGGATATACACACAATAGTGGG - Intergenic
988604866 5:32670317-32670339 TTGGACAAACACACAAAGCAAGG - Intergenic
989153354 5:38321345-38321367 CTGTAAATACAGACGAAGCTTGG + Intronic
989164251 5:38419115-38419137 TTGGACATACAGACATACCAGGG - Intronic
989265903 5:39473594-39473616 TTGTTTATACAGTCAATGCTTGG + Intergenic
991125535 5:63065844-63065866 TTTAATCTACAGACACAGCTGGG - Intergenic
991525660 5:67555214-67555236 TTGGATATATACACAAAAGTGGG + Intergenic
992043383 5:72860225-72860247 TTGGATATATAGAAAATGCCTGG - Intronic
992501312 5:77347031-77347053 ATGGATAGACAGACACAGATAGG - Intronic
993206442 5:84886794-84886816 TTGCCTAGTCAGACAAAGCTGGG + Intergenic
994370985 5:98967429-98967451 TTGGATATACAGTCAGAAGTGGG - Intergenic
994525194 5:100898406-100898428 TTGGATATTCTGAAAAGGCTTGG - Intronic
994599001 5:101877862-101877884 TAGAATATACAGACAAGGCAGGG + Intergenic
995239209 5:109866599-109866621 TTGAACATACAGACTACGCTTGG - Intronic
995488964 5:112669831-112669853 GAGGAAATACAGACAAAGCAAGG - Intergenic
995550949 5:113280776-113280798 TTGGATATTCAGACCAACCTAGG + Intronic
996205927 5:120735364-120735386 TTGGATATACATTCAAAAGTGGG + Intergenic
996494670 5:124140075-124140097 CAGGAAATACAGACAGAGCTTGG + Intergenic
999078537 5:148821259-148821281 TTGAAAAAACAGACAAAACTTGG - Intergenic
999765226 5:154735484-154735506 TTGGATATACACACAGAAGTGGG + Intronic
1001714596 5:173804620-173804642 TTGGATATACAGTCAATCCTTGG - Intergenic
1003778059 6:9391378-9391400 ATGGATTTAAAGACAAAGCATGG - Intergenic
1005545503 6:26864869-26864891 TTATATATAATGACAAAGCTTGG + Intergenic
1008185272 6:48382053-48382075 TTAAATATAAAGACAAAGATAGG + Intergenic
1008336025 6:50305890-50305912 TTGGCCATACAGACAAACCCTGG - Intergenic
1010318396 6:74477373-74477395 TTTGTTATAAATACAAAGCTGGG - Intergenic
1010426853 6:75737341-75737363 TTGCATATACAGAGCCAGCTGGG - Intergenic
1010679973 6:78787439-78787461 TTGGATATACAGATTAATTTGGG - Intergenic
1012076756 6:94697331-94697353 CTGGATATAAAGCAAAAGCTTGG - Intergenic
1012355218 6:98306208-98306230 TTGGAAATTCAGAAAAGGCTTGG + Intergenic
1014394650 6:120910950-120910972 TTGAACCTACAGACCAAGCTGGG + Intergenic
1014634438 6:123827754-123827776 TTAGATCTAGAGACAAAGGTAGG + Intronic
1014991222 6:128079717-128079739 ATGAATATAAAGACAAAGCATGG + Intronic
1015276513 6:131388045-131388067 TTGAATATAGAGCCAAAGCCTGG - Intergenic
1017001516 6:150000501-150000523 ATGGATATACAGACACAGACAGG + Intergenic
1017035283 6:150261732-150261754 TTTGATGTACAGAAAAATCTAGG + Intergenic
1018201007 6:161395755-161395777 TTGTCTACACAGCCAAAGCTGGG + Intronic
1022300506 7:29098121-29098143 CTGGCTATACAGACAAATCAAGG + Intronic
1022625799 7:32034678-32034700 TGGGATATAGTGACAAAGGTGGG - Intronic
1023336443 7:39175616-39175638 ATTGATATAAAGACAGAGCTGGG - Intronic
1023972442 7:45000748-45000770 TTGGATATCCAGTAAAAGCAAGG + Intronic
1024376386 7:48643296-48643318 ATGGTTATACAGTCAAAGTTTGG + Exonic
1025064476 7:55841437-55841459 TTAGATACACAGACAAGGCTGGG + Intronic
1026548524 7:71346580-71346602 TTGAAGATACACACAGAGCTGGG - Intronic
1026946359 7:74318855-74318877 TTGGAGAGACAAACACAGCTGGG + Intronic
1027502879 7:78977015-78977037 TTGGATTTATAGACCAAGTTGGG - Intronic
1028813302 7:95114043-95114065 TTGGCCATACAAACACAGCTGGG + Intronic
1028814483 7:95129020-95129042 TTTTATATACAGTGAAAGCTAGG + Intronic
1029519244 7:101049671-101049693 TTGGATATGCAGAGACAGCAGGG - Intronic
1037105366 8:15100524-15100546 TTGAATCTACAGATAAAGTTGGG - Intronic
1040766150 8:50913630-50913652 TTTCCTATACAGACAAAGTTTGG - Intergenic
1041879148 8:62727766-62727788 TTGAATATATAGACTAAGTTGGG - Intronic
1043361858 8:79481936-79481958 TTTGATGTACATACAAAGATAGG - Intergenic
1043967254 8:86493310-86493332 TTGGATATACATCCAAAAGTGGG - Intronic
1044174605 8:89103491-89103513 TTGGATATGTATACAAAGGTGGG - Intergenic
1044293536 8:90500773-90500795 CTGGCTATACAGAGAAGGCTGGG - Intergenic
1045139502 8:99265141-99265163 TGGGGTAAACAGACAAAGCCAGG - Intronic
1046316966 8:112516603-112516625 TTAAATAGAAAGACAAAGCTTGG + Intronic
1046814278 8:118566895-118566917 TTGGATGAACAAACAAAACTTGG + Intronic
1048026883 8:130595494-130595516 TTTGATCTAGAGTCAAAGCTTGG + Intergenic
1051294336 9:15579144-15579166 TTTGATGTACAGACTTAGCTGGG + Intronic
1052350988 9:27457998-27458020 TTGGAAATACAGAGAAAGGGTGG + Intronic
1055076413 9:72219913-72219935 TTGGATATACACCCAAAAGTGGG - Intronic
1055079104 9:72250050-72250072 TTGGAAATACAGACTAAGACTGG - Intronic
1055318192 9:75055126-75055148 TTAGAAATAAAGACAAGGCTGGG - Intergenic
1055880263 9:80992804-80992826 TTGAATATATAGATGAAGCTGGG + Intergenic
1056924801 9:90825295-90825317 TTGAATCTACAGATCAAGCTTGG - Intronic
1057833127 9:98422282-98422304 TTAGAAATACAGACAATTCTAGG + Intronic
1058139864 9:101346008-101346030 TGGGATGCACAGGCAAAGCTTGG + Intergenic
1058727770 9:107819527-107819549 TTGGATCTACTTTCAAAGCTGGG - Intergenic
1061709711 9:132479411-132479433 TTTCAGATACAGACACAGCTGGG + Intronic
1185939181 X:4295437-4295459 TTGGATAAACAGGACAAGCTTGG - Intergenic
1186992824 X:15087923-15087945 TTGTATAAACAAACACAGCTGGG - Intergenic
1189004515 X:36982107-36982129 TTGCAAACACACACAAAGCTGGG + Intergenic
1189044458 X:37575437-37575459 TTGCAAACACACACAAAGCTGGG - Intronic
1189161425 X:38813111-38813133 GAGGATATACAGATAAAGCGAGG + Intergenic
1190704026 X:53011123-53011145 TTGAATATAAAGACACAGATAGG + Intergenic
1192703653 X:73504053-73504075 TTGGATATACACACAGAAGTGGG - Intergenic
1198406959 X:136322687-136322709 TTGGCAATACAGTCAAATCTGGG - Intronic
1200686071 Y:6261103-6261125 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1200991607 Y:9352350-9352372 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1200994263 Y:9372626-9372648 TTGGAGAAACAGAAAAAGGTTGG - Intronic
1200996927 Y:9392966-9392988 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1200999442 Y:9461518-9461540 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1201002097 Y:9481824-9481846 TTGGAGAAACAGAAAAAGGTTGG - Intronic
1201004762 Y:9502110-9502132 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1201007415 Y:9522436-9522458 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1201010023 Y:9542288-9542310 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1201760480 Y:17531596-17531618 TTGGATAAACAGGCAAAAGTTGG - Intergenic
1201841074 Y:18374394-18374416 TTGGATAAACAGGCAAAAGTTGG + Intergenic
1201966882 Y:19747234-19747256 TTGAATCTACAGACAAATTTAGG + Intergenic