ID: 1183257335

View in Genome Browser
Species Human (GRCh38)
Location 22:36770968-36770990
Sequence AAGAAAAAGGAGAAGCAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2439
Summary {0: 1, 1: 0, 2: 22, 3: 278, 4: 2138}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183257335_1183257339 -4 Left 1183257335 22:36770968-36770990 CCCGCCTGCTTCTCCTTTTTCTT 0: 1
1: 0
2: 22
3: 278
4: 2138
Right 1183257339 22:36770987-36771009 TCTTAGTACTACCCTAGCAATGG 0: 1
1: 0
2: 0
3: 5
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183257335 Original CRISPR AAGAAAAAGGAGAAGCAGGC GGG (reversed) Intronic
Too many off-targets to display for this crispr