ID: 1183258244

View in Genome Browser
Species Human (GRCh38)
Location 22:36776957-36776979
Sequence CTTGTCCAGGCCAGGGATTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183258244_1183258258 28 Left 1183258244 22:36776957-36776979 CCTAAATCCCTGGCCTGGACAAG No data
Right 1183258258 22:36777008-36777030 CCTAGGAGAACCCGCCTTGTGGG No data
1183258244_1183258254 11 Left 1183258244 22:36776957-36776979 CCTAAATCCCTGGCCTGGACAAG No data
Right 1183258254 22:36776991-36777013 CTCAGCCTCAGGATGGGCCTAGG No data
1183258244_1183258256 27 Left 1183258244 22:36776957-36776979 CCTAAATCCCTGGCCTGGACAAG No data
Right 1183258256 22:36777007-36777029 GCCTAGGAGAACCCGCCTTGTGG No data
1183258244_1183258251 5 Left 1183258244 22:36776957-36776979 CCTAAATCCCTGGCCTGGACAAG No data
Right 1183258251 22:36776985-36777007 TCATCCCTCAGCCTCAGGATGGG No data
1183258244_1183258250 4 Left 1183258244 22:36776957-36776979 CCTAAATCCCTGGCCTGGACAAG No data
Right 1183258250 22:36776984-36777006 CTCATCCCTCAGCCTCAGGATGG No data
1183258244_1183258259 29 Left 1183258244 22:36776957-36776979 CCTAAATCCCTGGCCTGGACAAG No data
Right 1183258259 22:36777009-36777031 CTAGGAGAACCCGCCTTGTGGGG No data
1183258244_1183258248 0 Left 1183258244 22:36776957-36776979 CCTAAATCCCTGGCCTGGACAAG No data
Right 1183258248 22:36776980-36777002 TCACCTCATCCCTCAGCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183258244 Original CRISPR CTTGTCCAGGCCAGGGATTT AGG (reversed) Intergenic
No off target data available for this crispr