ID: 1183258895

View in Genome Browser
Species Human (GRCh38)
Location 22:36781481-36781503
Sequence GGTGAAGGGTTCTTAGTTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183258888_1183258895 0 Left 1183258888 22:36781458-36781480 CCTCGGCACTATTGACATTTGGG No data
Right 1183258895 22:36781481-36781503 GGTGAAGGGTTCTTAGTTATGGG No data
1183258885_1183258895 5 Left 1183258885 22:36781453-36781475 CCCTACCTCGGCACTATTGACAT No data
Right 1183258895 22:36781481-36781503 GGTGAAGGGTTCTTAGTTATGGG No data
1183258886_1183258895 4 Left 1183258886 22:36781454-36781476 CCTACCTCGGCACTATTGACATT No data
Right 1183258895 22:36781481-36781503 GGTGAAGGGTTCTTAGTTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183258895 Original CRISPR GGTGAAGGGTTCTTAGTTAT GGG Intergenic
No off target data available for this crispr