ID: 1183259209

View in Genome Browser
Species Human (GRCh38)
Location 22:36783417-36783439
Sequence TTCTATTTGCAGAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183259209_1183259217 16 Left 1183259209 22:36783417-36783439 CCTTCTTCCCTCTGCAAATAGAA No data
Right 1183259217 22:36783456-36783478 CCATCTAATGTACTTTGGAGTGG No data
1183259209_1183259215 11 Left 1183259209 22:36783417-36783439 CCTTCTTCCCTCTGCAAATAGAA No data
Right 1183259215 22:36783451-36783473 CTCTTCCATCTAATGTACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183259209 Original CRISPR TTCTATTTGCAGAGGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr