ID: 1183259866

View in Genome Browser
Species Human (GRCh38)
Location 22:36787751-36787773
Sequence TGCATCCCAGGCGGCCCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183259859_1183259866 26 Left 1183259859 22:36787702-36787724 CCTGGAGAAGCTGGGGTGGTAAG No data
Right 1183259866 22:36787751-36787773 TGCATCCCAGGCGGCCCCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183259866 Original CRISPR TGCATCCCAGGCGGCCCCGC AGG Intergenic
No off target data available for this crispr