ID: 1183260427

View in Genome Browser
Species Human (GRCh38)
Location 22:36791490-36791512
Sequence ATACGCTCCCTGGCACAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183260427_1183260434 -2 Left 1183260427 22:36791490-36791512 CCCCTTTGTGCCAGGGAGCGTAT No data
Right 1183260434 22:36791511-36791533 ATGAAGTGCTGGGGTTACAACGG No data
1183260427_1183260435 4 Left 1183260427 22:36791490-36791512 CCCCTTTGTGCCAGGGAGCGTAT No data
Right 1183260435 22:36791517-36791539 TGCTGGGGTTACAACGGTGAAGG No data
1183260427_1183260436 19 Left 1183260427 22:36791490-36791512 CCCCTTTGTGCCAGGGAGCGTAT No data
Right 1183260436 22:36791532-36791554 GGTGAAGGATTCCAGCACGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183260427 Original CRISPR ATACGCTCCCTGGCACAAAG GGG (reversed) Intergenic
No off target data available for this crispr