ID: 1183264010

View in Genome Browser
Species Human (GRCh38)
Location 22:36814681-36814703
Sequence CACTAGTACCAGAGGGCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 201}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183264000_1183264010 7 Left 1183264000 22:36814651-36814673 CCCTGGCTTGCCTAGAAATTGCA No data
Right 1183264010 22:36814681-36814703 CACTAGTACCAGAGGGCTGGGGG 0: 1
1: 0
2: 0
3: 12
4: 201
1183264002_1183264010 -3 Left 1183264002 22:36814661-36814683 CCTAGAAATTGCACCAGCCACAC 0: 1
1: 0
2: 1
3: 10
4: 148
Right 1183264010 22:36814681-36814703 CACTAGTACCAGAGGGCTGGGGG 0: 1
1: 0
2: 0
3: 12
4: 201
1183264001_1183264010 6 Left 1183264001 22:36814652-36814674 CCTGGCTTGCCTAGAAATTGCAC 0: 1
1: 0
2: 0
3: 18
4: 84
Right 1183264010 22:36814681-36814703 CACTAGTACCAGAGGGCTGGGGG 0: 1
1: 0
2: 0
3: 12
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183264010 Original CRISPR CACTAGTACCAGAGGGCTGG GGG Intronic
900645710 1:3707800-3707822 CCCTAGTCCCTGAGGGCTGCGGG + Intronic
900991546 1:6100468-6100490 CAATGGTGCCAGAGGGCAGGTGG + Exonic
901114261 1:6828978-6829000 CACTTGAACCTGAGGGGTGGAGG - Intronic
903659822 1:24970163-24970185 CTCTTGTACCACAGGGGTGGTGG + Intergenic
905870594 1:41402016-41402038 CACTATGACCACAGGGCTGGAGG - Intergenic
907462921 1:54615968-54615990 CCCCAGGGCCAGAGGGCTGGGGG + Intronic
907516979 1:54998995-54999017 CACCAGTTCAACAGGGCTGGAGG - Exonic
908298053 1:62732980-62733002 CACTTGTACCCGAGAGGTGGAGG - Intergenic
908905808 1:69007612-69007634 CACTTGAACCAGGGAGCTGGAGG - Intergenic
909955090 1:81769945-81769967 CACTTGAACCTGAGGGGTGGAGG - Intronic
912478151 1:109955721-109955743 CACTTGAACCAGGGAGCTGGAGG - Intergenic
913537006 1:119782771-119782793 GAGTATTACCTGAGGGCTGGGGG - Intergenic
914171677 1:145231072-145231094 CACTTGAACCAGGGAGCTGGAGG - Intergenic
914526785 1:148475033-148475055 CACTTGAACCAGGGAGCTGGAGG - Intergenic
915104412 1:153524051-153524073 CACTAGAACCCGAGAGGTGGAGG + Intergenic
916680633 1:167101715-167101737 CACTTGAACCAGAGAGGTGGAGG + Intronic
917685910 1:177415979-177416001 CATGAATAGCAGAGGGCTGGAGG - Intergenic
919651550 1:200154478-200154500 CTCAAGTACCAGAGAGATGGTGG + Intronic
920213471 1:204345638-204345660 CACAAGTACTAGAGAGCTGGTGG + Intronic
922619316 1:226980513-226980535 CACAAGTACCACAGGCCTAGGGG + Intronic
923334755 1:232958508-232958530 CTCTAATCTCAGAGGGCTGGTGG + Intronic
923461459 1:234213090-234213112 CACTTCTGCCAGAGAGCTGGGGG + Intronic
1065783826 10:29194568-29194590 CACTAGTACCTGGTGGGTGGAGG - Intergenic
1066418858 10:35246088-35246110 AACTAGCACCAAGGGGCTGGGGG + Intergenic
1069371818 10:67755716-67755738 CACTTGAACCAGGGAGCTGGAGG + Intergenic
1069774707 10:70919613-70919635 CCCCAGGCCCAGAGGGCTGGAGG - Intergenic
1077732445 11:4746748-4746770 CACTTGAACCAGAGAGGTGGAGG + Intronic
1079152987 11:17918189-17918211 CACTTGTACCAGCAGGCAGGTGG - Intronic
1083248820 11:61451492-61451514 CACTAGAACCCGAGAGGTGGAGG + Intronic
1083452806 11:62757419-62757441 AACTAGTACCGGGGGGCCGGTGG - Intergenic
1084467400 11:69334081-69334103 CACTAATCCCAGAGGCCTGGTGG - Intronic
1086337894 11:85817345-85817367 CACTAGCCCCAGGGGGCTGGTGG - Intergenic
1088515387 11:110627170-110627192 CACTTGAACCTGAGGGGTGGTGG - Intronic
1093194874 12:16118747-16118769 CAGCAGTACAAGGGGGCTGGTGG - Intergenic
1093372542 12:18381997-18382019 CACAAATCCCAGAAGGCTGGAGG - Intronic
1094416205 12:30217796-30217818 GGCAAGTCCCAGAGGGCTGGAGG - Intergenic
1097071320 12:56357118-56357140 CACTTGAACCAGGGGGATGGTGG - Intronic
1097842738 12:64337771-64337793 CACTTGAACCTGAGGGGTGGAGG + Intronic
1101329237 12:103744086-103744108 CACTAGTACGGTAGTGCTGGAGG + Intronic
1102437056 12:112932507-112932529 CACTTGAACCTGGGGGCTGGTGG + Intergenic
1103416136 12:120742408-120742430 AACTTGTCCCAGAGGGCTAGAGG - Intergenic
1103480619 12:121247850-121247872 CACTAGTCCCAGTGGGCCGGCGG - Intronic
1103890729 12:124237247-124237269 CAGTAGCCCCACAGGGCTGGTGG - Intronic
1105887031 13:24650864-24650886 CACTTGAACCAGAGAGGTGGAGG + Intergenic
1107430063 13:40332468-40332490 CAGAAGTACCAGAGGCCTTGGGG + Intergenic
1107841854 13:44466250-44466272 AACTAGTACCAGAGGGATTTGGG + Intronic
1108455166 13:50605793-50605815 CACTTGAACCAGGGAGCTGGAGG - Intronic
1108642229 13:52393984-52394006 CATTAGAACAATAGGGCTGGGGG - Intronic
1108955128 13:56144214-56144236 CACTAGAACCAGAGAGGTGGAGG + Intergenic
1109923450 13:69102076-69102098 CACAAGGAACAGAGGACTGGTGG - Intergenic
1110612145 13:77501058-77501080 CACTTGAACCAGGGAGCTGGAGG - Intergenic
1113832893 13:113310880-113310902 CACTAGCACCAGAGGGCCAAGGG - Intronic
1119083171 14:71716149-71716171 CACTAATTCCAAAGGACTGGGGG - Intronic
1119818368 14:77591805-77591827 CACTTGAACCAGAGAGGTGGAGG - Intronic
1120951579 14:90046614-90046636 CACTTGAACCTGGGGGCTGGAGG - Intergenic
1122264815 14:100541629-100541651 CCCTGGCACCAGAGGGCTGCAGG + Intronic
1122827280 14:104376412-104376434 CACGAGAGCCAGAGGGTTGGGGG - Intergenic
1123026970 14:105429838-105429860 CACTTGAACCCGAGAGCTGGAGG - Intronic
1127682776 15:61313730-61313752 GACTAGTACCAGAAGGCCTGAGG - Intergenic
1128552995 15:68610169-68610191 CACTGGAACCAGAGGGCTGCAGG - Intronic
1128982717 15:72198536-72198558 CTGTAGTGCCAAAGGGCTGGGGG - Intergenic
1129203282 15:74019052-74019074 CAGTCTTACCAGAGGGCTGGGGG + Intronic
1129222836 15:74143091-74143113 CACTTGAACCAGGGAGCTGGAGG - Intergenic
1130003443 15:80068453-80068475 CACTTGAACCCGGGGGCTGGAGG - Intronic
1130005133 15:80088851-80088873 CCGTAGTTCCACAGGGCTGGTGG + Intronic
1130175265 15:81562380-81562402 CACTTGAACCTGAGAGCTGGAGG + Intergenic
1133310629 16:4844028-4844050 CACTTGTACCCGAGAGGTGGAGG + Intronic
1136280820 16:29210164-29210186 CTCCACTCCCAGAGGGCTGGGGG + Intergenic
1138671696 16:58620736-58620758 CAGTAGTACCACAGGGAAGGAGG + Intronic
1139120458 16:64009852-64009874 CAAGAGTACCATAGGGCAGGTGG - Intergenic
1139479318 16:67220368-67220390 CACTTGAACCAGAGAGGTGGAGG - Intronic
1140138451 16:72229948-72229970 ACATATTACCAGAGGGCTGGAGG + Intergenic
1142048133 16:87939167-87939189 CAGCAGTACCCGTGGGCTGGGGG + Intergenic
1142085176 16:88176086-88176108 CTCCACTCCCAGAGGGCTGGGGG + Intergenic
1143857046 17:9859733-9859755 CACTTGAACCAGGGAGCTGGAGG + Intronic
1146939656 17:36835776-36835798 CACTTGAACCTGAGGGGTGGAGG - Intergenic
1148357197 17:46983378-46983400 CACTTGAACCTGAGAGCTGGAGG - Intronic
1150230417 17:63546633-63546655 CATCAGGAGCAGAGGGCTGGAGG - Exonic
1150939850 17:69680871-69680893 CAGTAGTATCAGAAGGCTGTTGG + Intergenic
1151725108 17:75878876-75878898 CAGAAGGACCAGAGGGATGGAGG - Intergenic
1152053912 17:78006910-78006932 CACTTGAACCTGAGGGGTGGAGG - Intronic
1152655028 17:81515274-81515296 CACTGGTTCCAGAAGGGTGGCGG - Intronic
1155477502 18:26249086-26249108 CACTTGAACCAGGGAGCTGGAGG + Intronic
1156902430 18:42316056-42316078 CACTAAAACCAGAGGGCAGAAGG - Intergenic
1156991318 18:43411424-43411446 CACTGCCACCAGAGAGCTGGTGG - Intergenic
1158744306 18:60180828-60180850 CACTGGTTGCCGAGGGCTGGAGG - Intergenic
1161776257 19:6263849-6263871 CACTGGTGCCAGAAGGCTGAAGG + Intronic
1161874603 19:6898329-6898351 AATTAGGACCACAGGGCTGGGGG - Intronic
1161921855 19:7272220-7272242 CACTTGAACCAGAGAGTTGGAGG + Intronic
1162812931 19:13175414-13175436 CGCTTGAACCCGAGGGCTGGAGG + Intergenic
1163438911 19:17311738-17311760 CACTAATAGCAGAGAACTGGGGG - Intronic
1165484154 19:36085197-36085219 CACTTGAACCAGAGAGGTGGAGG - Intronic
1166355083 19:42222425-42222447 TATTAGTGCCAGAGGGCAGGTGG - Intronic
1166566138 19:43766796-43766818 CACTTGTAACTGAGAGCTGGAGG + Exonic
1166946566 19:46400827-46400849 CACTGGAACCAGGGAGCTGGAGG + Intergenic
1167234864 19:48308256-48308278 CACTTGAACCAGGGAGCTGGAGG - Intronic
1167716542 19:51145993-51146015 CTCCAGTACCAGAGGGTTTGAGG - Exonic
1168326002 19:55538580-55538602 CACTCGAACCAGAGAGTTGGAGG - Intergenic
1202645793 1_KI270706v1_random:140099-140121 CACTTTGACCAGTGGGCTGGTGG + Intergenic
925807477 2:7665145-7665167 CACCAGTTCCAGAGAGCTGACGG + Intergenic
926232726 2:11017133-11017155 CACAAGCACTGGAGGGCTGGGGG + Intergenic
926888463 2:17618914-17618936 CAGTAGGACCAAAGTGCTGGGGG - Intronic
927818131 2:26238689-26238711 CACTATAACCAGGAGGCTGGTGG + Intronic
931376948 2:61716597-61716619 CACTTGAACCTGAGGGGTGGAGG - Intergenic
935956856 2:108385562-108385584 CTCTAGGAGCAGAGGGCGGGTGG - Intronic
937689260 2:124736144-124736166 CACTAGAACCAGGGAGGTGGAGG + Intronic
938259125 2:129882745-129882767 GGCTAGTTCCAGATGGCTGGAGG - Intergenic
938318412 2:130345795-130345817 CAGTAGGACCAAAGGGCAGGTGG - Exonic
940052704 2:149480742-149480764 GACTACTATCAGAGGGCTGCTGG - Intergenic
940309836 2:152266707-152266729 CACTTGAACCTGAGAGCTGGAGG - Intergenic
943786069 2:191880478-191880500 CACTAGAGCCAGAGGTCAGGAGG + Intergenic
946448173 2:219757562-219757584 CAGGAGTAGCAGAGGGCTGTGGG - Intergenic
947415782 2:229894069-229894091 CACTTGAACCTGAGGGATGGAGG + Intronic
948667708 2:239546625-239546647 CACTCGCAACAGAGGGCGGGTGG - Intergenic
1170226979 20:14001784-14001806 CAGTAGCACGAGAGGGTTGGGGG + Intronic
1170704579 20:18733547-18733569 CACTAGGGCCTGAAGGCTGGAGG + Intronic
1172205239 20:33158752-33158774 CATTAGTACCACAGGGATTGGGG - Intergenic
1175948610 20:62570354-62570376 CACTTGTCCCAGCGTGCTGGGGG + Intronic
1176606089 21:8832650-8832672 CACTTTGACCAGTGGGCTGGTGG - Intergenic
1177051760 21:16244358-16244380 CACTAGAACCCGAGAGGTGGAGG + Intergenic
1178444888 21:32630628-32630650 AACAAGTATGAGAGGGCTGGTGG + Intronic
1180348387 22:11724256-11724278 CACTTTGACCAGTGGGCTGGTGG - Intergenic
1180356160 22:11842348-11842370 CACTTTGACCAGTGGGCTGGTGG - Intergenic
1180382097 22:12149979-12150001 CACTTTGACCAGTGGGCTGGTGG + Intergenic
1180648790 22:17361653-17361675 CACTTGAACCCGGGGGCTGGGGG + Intronic
1180965093 22:19784015-19784037 ACCTAGGACCACAGGGCTGGTGG + Exonic
1181302667 22:21892489-21892511 CACTTGAACCTGGGGGCTGGAGG + Intergenic
1182192539 22:28477782-28477804 CAGTTGTACGAGAGGGCAGGTGG - Intronic
1182725364 22:32441086-32441108 CACTAGGAGCAGGGGGTTGGGGG - Intronic
1183264010 22:36814681-36814703 CACTAGTACCAGAGGGCTGGGGG + Intronic
1183480532 22:38062329-38062351 CACTTGAACCCGGGGGCTGGAGG - Intronic
950821604 3:15765754-15765776 CACTTGAACCAGGGAGCTGGAGG + Intronic
951942079 3:28090505-28090527 CCCTTGTAAAAGAGGGCTGGGGG + Intergenic
954233122 3:49234254-49234276 CACTTGAACCAGGGAGCTGGAGG - Intronic
955704388 3:61713242-61713264 CACTTGAACCAGGGAGCTGGAGG - Intronic
959271848 3:104221635-104221657 CACTAGAACCTGAGAGGTGGAGG - Intergenic
965459264 3:168941472-168941494 CACTTGAACCCGGGGGCTGGAGG + Intergenic
968313666 3:197704459-197704481 CCCTGGTACCAGAGGGGTAGAGG + Intronic
968676569 4:1884475-1884497 CACTTGAACCAGGGAGCTGGAGG - Intronic
969676434 4:8616873-8616895 CACGAGCCCCAGAGGGCAGGGGG + Intronic
972290233 4:37684867-37684889 CACTTGAACCAGAGAGCTGGAGG + Intronic
972729527 4:41780205-41780227 CATTGGTACCAGAGAGGTGGAGG + Intergenic
973372019 4:49258517-49258539 CACTTTGACCAGTGGGCTGGTGG + Intergenic
973379650 4:49311366-49311388 GAAGAGTACCTGAGGGCTGGGGG - Intergenic
973388986 4:49536801-49536823 CACTTTGACCAGTGGGCTGGTGG - Intergenic
975151187 4:71022701-71022723 CATTAGTACCAGACTGCTGAGGG - Intronic
976648670 4:87411998-87412020 CACTTGAACCCGAGAGCTGGAGG + Intergenic
979537333 4:121838018-121838040 CACTTGTACCAGGGAGGTGGAGG + Intronic
980058807 4:128106105-128106127 CACTTGAACCAGGGAGCTGGAGG - Intronic
981042201 4:140233508-140233530 CGCTTGAACCAGGGGGCTGGAGG + Intergenic
981578592 4:146230039-146230061 CAGAAGTGCCAGAGGTCTGGAGG - Intergenic
982173415 4:152683031-152683053 CACTTGTACCTGAGAGGTGGAGG + Intergenic
984333826 4:178361609-178361631 CACAAGCACCAGAGGTCTGCTGG + Intergenic
985738478 5:1600016-1600038 CACTTGAACCAGAGAGTTGGAGG - Intergenic
986454971 5:7909059-7909081 CAGTAGTATGAGAAGGCTGGGGG + Intergenic
986480764 5:8184685-8184707 CACTTGGATGAGAGGGCTGGTGG - Intergenic
990408828 5:55519664-55519686 CACTTGAACCAGGGAGCTGGCGG + Intronic
990493671 5:56325937-56325959 CACTAGAACTAGAAGGATGGGGG + Intergenic
991860591 5:71009604-71009626 CACTTGTACCTGAGAGGTGGAGG + Intronic
997576349 5:134980512-134980534 CACTTGAACCAGGGAGCTGGAGG - Intronic
1001028601 5:168245212-168245234 CACTATTACCATTGGGGTGGGGG + Intronic
1001150331 5:169221707-169221729 CACTAGGAACTGATGGCTGGCGG - Intronic
1001529219 5:172450834-172450856 CACTAGAGCCCGAGGGCTTGGGG - Intronic
1001848961 5:174946299-174946321 CACCTGTACCCCAGGGCTGGTGG + Intergenic
1002663924 5:180809501-180809523 AACTAGTTGAAGAGGGCTGGTGG - Intronic
1004072823 6:12317006-12317028 CACTTGAACCAGGGGGGTGGAGG + Intergenic
1005651079 6:27885626-27885648 CGCTTGAACCAGAGGGGTGGAGG - Intergenic
1005995305 6:30927313-30927335 CACTTGTACCAGAGAGGTAGAGG - Intergenic
1006856302 6:37135711-37135733 CACTTGAACCAGGGAGCTGGAGG + Intergenic
1007748551 6:44057850-44057872 CACCTGTACCAGAGGCCTGGTGG + Intergenic
1008524920 6:52398288-52398310 CACTTGAACCAGAGAGGTGGAGG - Intronic
1011276477 6:85636360-85636382 CACTTGAACCTGAGGGGTGGAGG + Intronic
1014543587 6:122705647-122705669 CACTTGAACCAGGGAGCTGGAGG - Intronic
1016703702 6:147082319-147082341 CACTTGAACCTGAGGGGTGGAGG + Intergenic
1018241419 6:161779021-161779043 CACTTGAACCAGAGAGGTGGAGG - Intronic
1018480034 6:164180943-164180965 CACTTGTGTCAGGGGGCTGGAGG + Intergenic
1019472213 7:1227130-1227152 CCCTAGTGCAAGAGGACTGGAGG + Intergenic
1022470892 7:30681453-30681475 CCCTACTACCAGAGGGGAGGAGG - Intronic
1022488361 7:30797816-30797838 CAGTAGTAGAAGAGAGCTGGTGG + Intronic
1023690252 7:42779083-42779105 CACTATTATCACAGGCCTGGAGG + Intergenic
1024053462 7:45644898-45644920 CACTAGTGCCAGCGTGGTGGAGG + Intronic
1025000239 7:55309840-55309862 CACTACTACCAGAGTGCAGCTGG - Intergenic
1026062194 7:67036542-67036564 CACTAGAGCCAGAGGTCAGGAGG + Intronic
1026716154 7:72790906-72790928 CACTAGAGCCAGAGGTCAGGAGG - Intronic
1026894248 7:74000805-74000827 CATGAGAACCAGGGGGCTGGAGG + Intergenic
1029306454 7:99623429-99623451 CACTAGTAGCAGGGAGGTGGGGG + Intronic
1032822238 7:135534700-135534722 CACTTGAACCAGAGGGGCGGAGG + Intergenic
1034868324 7:154659626-154659648 CACTAGAAGCAAAGGGCTTGAGG - Intronic
1035223597 7:157421273-157421295 CACTAGAACCCGAGAGTTGGAGG - Intergenic
1039063095 8:33587829-33587851 CACTTGTATCAGAGAGGTGGAGG - Intergenic
1045319279 8:101069640-101069662 CACAGGTACTAGAGGGCTGGGGG + Intergenic
1046198062 8:110888971-110888993 CAGAAGTTCCAGAGGCCTGGAGG + Intergenic
1046352650 8:113035468-113035490 CAGTAGTTGCTGAGGGCTGGAGG + Intronic
1047673249 8:127171719-127171741 CACTTGAACCAGGGAGCTGGAGG + Intergenic
1048211120 8:132455188-132455210 CACTTGAACCCGAGGGGTGGAGG - Intronic
1049647868 8:143744277-143744299 CACAAGTTCCAGGGGGCAGGAGG + Intergenic
1051316009 9:15833069-15833091 CACTTGAACCAGAGAGGTGGAGG - Intronic
1052777957 9:32752329-32752351 CACTTGAACCAGAGGGGTGGAGG + Intergenic
1053318098 9:37069608-37069630 CACTAGAACCTGGGAGCTGGAGG + Intergenic
1055943897 9:81675782-81675804 CACTTGAACCAGGGGGTTGGAGG - Intronic
1057613037 9:96563564-96563586 CACTTGAACCAGGGGGGTGGAGG + Intronic
1057799732 9:98183200-98183222 CAGTAGCAACAGAGGGTTGGAGG - Intronic
1058877041 9:109253251-109253273 CACTAATGACAGAGGGATGGCGG + Intronic
1062427785 9:136513881-136513903 CACTTGAACCTGAGGGGTGGAGG + Intronic
1062450993 9:136615742-136615764 CCCTAGTCCCAGAGGGGAGGTGG - Intergenic
1185859344 X:3563010-3563032 CACTAGAACCTGAGAGGTGGAGG + Intergenic
1188835374 X:34948259-34948281 TACCAGTACCAGTGTGCTGGTGG - Intergenic
1192408918 X:70915157-70915179 CACTTGAACCAGAGAGGTGGAGG - Intergenic
1193678558 X:84487541-84487563 CACTAGTACCATTTGGGTGGTGG + Intronic
1196231739 X:113232166-113232188 GAATAGTACTAGGGGGCTGGGGG - Intergenic
1198401239 X:136270274-136270296 CACTAATACCAGGAGGCAGGAGG + Intergenic
1198809348 X:140519899-140519921 CGCTTGAACCAGAGAGCTGGAGG - Intergenic
1200235407 X:154465650-154465672 CACTTGTACAGGAGGGCTGCAGG - Exonic
1201484460 Y:14477349-14477371 CACTTGAACCTGAGAGCTGGAGG + Intergenic