ID: 1183267442

View in Genome Browser
Species Human (GRCh38)
Location 22:36837767-36837789
Sequence CTCTGCAGAAATGAGTGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183267434_1183267442 10 Left 1183267434 22:36837734-36837756 CCTGGGAGTGATATTTGGGCCTC No data
Right 1183267442 22:36837767-36837789 CTCTGCAGAAATGAGTGATGGGG No data
1183267437_1183267442 -9 Left 1183267437 22:36837753-36837775 CCTCAGGGCCCTTACTCTGCAGA No data
Right 1183267442 22:36837767-36837789 CTCTGCAGAAATGAGTGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183267442 Original CRISPR CTCTGCAGAAATGAGTGATG GGG Intergenic
No off target data available for this crispr