ID: 1183270141

View in Genome Browser
Species Human (GRCh38)
Location 22:36856912-36856934
Sequence CCTAGCACACAGTGGGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183270135_1183270141 26 Left 1183270135 22:36856863-36856885 CCTCTAGTAAGTGCGTGTCTCAA No data
Right 1183270141 22:36856912-36856934 CCTAGCACACAGTGGGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183270141 Original CRISPR CCTAGCACACAGTGGGTGTC TGG Intergenic
No off target data available for this crispr