ID: 1183271527

View in Genome Browser
Species Human (GRCh38)
Location 22:36865442-36865464
Sequence GTCTCGTGGGAGGAAGCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183271527_1183271534 2 Left 1183271527 22:36865442-36865464 CCCTCAGCTTCCTCCCACGAGAC No data
Right 1183271534 22:36865467-36865489 GCCCTCTGACTTCATGGTCTTGG 0: 1
1: 0
2: 1
3: 13
4: 187
1183271527_1183271532 -4 Left 1183271527 22:36865442-36865464 CCCTCAGCTTCCTCCCACGAGAC No data
Right 1183271532 22:36865461-36865483 AGACCAGCCCTCTGACTTCATGG 0: 1
1: 0
2: 4
3: 20
4: 249
1183271527_1183271537 20 Left 1183271527 22:36865442-36865464 CCCTCAGCTTCCTCCCACGAGAC No data
Right 1183271537 22:36865485-36865507 CTTGGCTTCCAGCGTCCCTGTGG 0: 1
1: 0
2: 1
3: 14
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183271527 Original CRISPR GTCTCGTGGGAGGAAGCTGA GGG (reversed) Intronic
No off target data available for this crispr