ID: 1183271938

View in Genome Browser
Species Human (GRCh38)
Location 22:36867769-36867791
Sequence CCTTGGGGGCAGACACTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 4, 2: 3, 3: 25, 4: 254}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183271938_1183271945 -6 Left 1183271938 22:36867769-36867791 CCATCCAGTGTCTGCCCCCAAGG 0: 1
1: 4
2: 3
3: 25
4: 254
Right 1183271945 22:36867786-36867808 CCAAGGTACCCACTGTCCTATGG No data
1183271938_1183271949 7 Left 1183271938 22:36867769-36867791 CCATCCAGTGTCTGCCCCCAAGG 0: 1
1: 4
2: 3
3: 25
4: 254
Right 1183271949 22:36867799-36867821 TGTCCTATGGGAATGCCAACAGG 0: 1
1: 0
2: 0
3: 20
4: 115
1183271938_1183271953 27 Left 1183271938 22:36867769-36867791 CCATCCAGTGTCTGCCCCCAAGG 0: 1
1: 4
2: 3
3: 25
4: 254
Right 1183271953 22:36867819-36867841 AGGTGGATCATAAGATCACACGG No data
1183271938_1183271951 10 Left 1183271938 22:36867769-36867791 CCATCCAGTGTCTGCCCCCAAGG 0: 1
1: 4
2: 3
3: 25
4: 254
Right 1183271951 22:36867802-36867824 CCTATGGGAATGCCAACAGGTGG No data
1183271938_1183271946 -5 Left 1183271938 22:36867769-36867791 CCATCCAGTGTCTGCCCCCAAGG 0: 1
1: 4
2: 3
3: 25
4: 254
Right 1183271946 22:36867787-36867809 CAAGGTACCCACTGTCCTATGGG 0: 1
1: 0
2: 0
3: 7
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183271938 Original CRISPR CCTTGGGGGCAGACACTGGA TGG (reversed) Intronic
901368322 1:8773746-8773768 CCTGGGAGGCAGAGACTGCAGGG + Intronic
902386096 1:16076780-16076802 CCCTGGGGGCGGGCAGTGGAAGG - Intergenic
904075960 1:27842644-27842666 AATTGGGGCCAGACACAGGATGG + Intronic
904482827 1:30804960-30804982 CATTGGGGGCACACAGGGGAAGG + Intergenic
905385872 1:37603659-37603681 GCATGGGGGCACACACTGGCAGG + Intergenic
908304653 1:62799952-62799974 CCATGGAGGCAGAGAGTGGAAGG - Intronic
909874308 1:80783447-80783469 GCTTTGGGGCAGATACTGTACGG - Intergenic
912502800 1:110133341-110133363 CCTCGGGGGCAAACACTGAGTGG + Intergenic
912857010 1:113178212-113178234 CTACGGGGGCAGACACCGGAAGG + Intergenic
912874117 1:113339185-113339207 CCTTGGAGGAAGACACAGGAGGG + Intergenic
915212830 1:154323269-154323291 CCTTGGGGCCAGTCACTGTCAGG - Exonic
915635076 1:157180750-157180772 CCCTGCTGGCAGACACTGGGTGG - Intergenic
916015954 1:160750161-160750183 CCATGGGAACAGACACTGTATGG + Intronic
917431966 1:174979309-174979331 CCTTTGAAGCAGACACTGGTTGG + Intronic
917624919 1:176835885-176835907 TCTTGGGGGCAGAACCTGGGGGG - Intronic
917725064 1:177820520-177820542 GCTTGGGGGCAGAAAATGGCAGG - Intergenic
919887101 1:201942509-201942531 CCTTGGAGGGAGACCCTGGAGGG + Intronic
921698943 1:218245339-218245361 CCTTGGTGGCAGCCCCGGGAGGG - Intergenic
923564983 1:235069918-235069940 CCTAGGGGACAGGGACTGGAGGG - Intergenic
924908624 1:248484220-248484242 CCTTGTGGGTGGACACTGCAGGG - Intergenic
924915488 1:248563842-248563864 CCTTGTGGGTGGACACTGCAGGG + Intergenic
1063650141 10:7927475-7927497 CATTTGGGGAAGACAGTGGAGGG - Intronic
1065306536 10:24374433-24374455 CCTTGGGTGCAGGCGCTAGAGGG - Intronic
1065883405 10:30057635-30057657 CCTTTGCTGCAGAGACTGGAAGG - Intronic
1067048525 10:42999327-42999349 CGTTGGGGGCTGACAGTGCAAGG - Intergenic
1067105746 10:43365050-43365072 CCTTGGGTGATGAGACTGGAAGG + Intergenic
1067434047 10:46264888-46264910 CCTTGTGGGCACCCACTTGATGG + Intergenic
1067763633 10:49069342-49069364 CCTCGAGTGCAGACACTTGATGG - Intronic
1070838891 10:79469427-79469449 CCATGGGAGAAGACACAGGAAGG + Intergenic
1071328188 10:84536975-84536997 CTTTGGGGTCAGAAACTGGATGG - Intergenic
1072430634 10:95367942-95367964 CCTTGGCTGCATCCACTGGAAGG - Intronic
1073112874 10:101073240-101073262 CCTTGGGGACAGACATGTGAGGG + Intergenic
1074853794 10:117458472-117458494 CCATGGGGGTAGACACGGGTCGG - Intergenic
1074913016 10:117928984-117929006 GGATGGAGGCAGACACTGGACGG - Intergenic
1075998014 10:126893939-126893961 CCTCTGGGGCAGACTTTGGAAGG - Intergenic
1077357364 11:2124676-2124698 GCGTGGGGGCAGAGACTGGAAGG - Intergenic
1077357374 11:2124723-2124745 GCGTGGGGGCAGAGACTGGACGG - Intergenic
1077882155 11:6359601-6359623 ACTTTGGGACAGACACTGGCTGG + Intergenic
1077991224 11:7414117-7414139 CCTTGAGGGCAGAGATTAGACGG + Intronic
1080426388 11:32158612-32158634 CCTAGAGGGGAGACACTGCAGGG - Intergenic
1080897930 11:36461664-36461686 CCAAGGAGGCAGACACAGGAAGG - Intronic
1081571963 11:44297380-44297402 ACTTTGGGGAAGCCACTGGAGGG - Intronic
1081996162 11:47365584-47365606 CCTTGGGGTCAGATACAGGTGGG - Intronic
1083297323 11:61722022-61722044 CCTCAGGGGCTGAGACTGGAGGG - Intronic
1083936093 11:65870904-65870926 CCCAGGGGACAGACACTGGAAGG + Intronic
1084383030 11:68825679-68825701 GGTGGGGGGCAGGCACTGGAGGG - Intronic
1084777514 11:71387256-71387278 CTTTGGGGGCTGTCACTGCAGGG - Intergenic
1084873672 11:72115045-72115067 CCTTGAGGGCAGGGACTGAATGG + Intronic
1084902989 11:72324113-72324135 CCTTGGGGGATGAGTCTGGAAGG + Intronic
1085052573 11:73387424-73387446 ACTTTGGGGCAGAAACTGGAAGG + Intronic
1085508986 11:77075838-77075860 TCTTGGGGGTAGTGACTGGAAGG - Intronic
1087051430 11:93889878-93889900 CACTGGGCACAGACACTGGAGGG - Intergenic
1087158563 11:94927415-94927437 CCTTGGAGGCAGACAGTGCAGGG + Intergenic
1089336078 11:117724936-117724958 CCAAGGGGCAAGACACTGGAAGG + Intronic
1089656405 11:119950068-119950090 CCTGGGGTCCTGACACTGGAAGG + Intergenic
1089919324 11:122193508-122193530 CCTTGGGGGCATACACAAGAAGG + Intergenic
1090158050 11:124462703-124462725 AGTTGTGGGCAGACAGTGGAAGG - Intergenic
1090880023 11:130825193-130825215 CCTTGGGGGAAGGGACTGGTGGG - Intergenic
1095262409 12:40111629-40111651 CTTTGGGGGAAGCCAGTGGAGGG - Intergenic
1096120900 12:49089012-49089034 CCTTGGTGGCAGGGCCTGGATGG - Intergenic
1096519663 12:52177513-52177535 CCCTGGGGGCACAGGCTGGAAGG - Intronic
1097023642 12:56037655-56037677 CCATGAGAGCAGAGACTGGAAGG + Exonic
1098403098 12:70094551-70094573 CCTTAGTGGCAGAGACTGGTAGG - Intergenic
1100608413 12:96170538-96170560 CCTCGGGGACAGTCACTAGAAGG + Intergenic
1100883143 12:99040372-99040394 TCTTCGTGGCAGCCACTGGAGGG - Intronic
1103080522 12:118020215-118020237 CCCTGGGGGCTGACACAGGCTGG + Intronic
1104381626 12:128312591-128312613 CAATGGAGGCAGACATTGGAGGG + Intronic
1104947765 12:132424360-132424382 CCTTTGGTGCAGACACTGAGAGG - Intergenic
1106183108 13:27384942-27384964 TTTTGGGGGAAGACAGTGGAGGG + Intergenic
1106483339 13:30153264-30153286 TCTGGGGAGAAGACACTGGAAGG + Intergenic
1107807059 13:44163331-44163353 ACTGGAGGGCAGACACTGGCAGG - Intergenic
1112558197 13:100488528-100488550 CCTTGGAGGCTGAGGCTGGAGGG + Intronic
1113836725 13:113332910-113332932 CCTGGGCTGCACACACTGGAGGG - Intronic
1113958648 13:114113057-114113079 ACTTGGGGGCAGGAGCTGGAGGG + Intronic
1115148585 14:30256470-30256492 GCTTTGGGGCAGAGACTGTAGGG + Intergenic
1118979642 14:70706127-70706149 CCTTGGGGACAGAAACTGTCTGG + Intergenic
1120723388 14:87911719-87911741 CCCTGAAGGCAGACTCTGGAAGG - Intronic
1120987151 14:90344109-90344131 GCTTTGGGGGAGACAGTGGATGG - Intergenic
1121047094 14:90796155-90796177 CCTCTGGGGCAGAGGCTGGATGG + Intronic
1121449024 14:93996205-93996227 CCTTGGGTTCAGACTCAGGAGGG - Intergenic
1121511583 14:94516712-94516734 TCTTGGGGACAGAAACTGTAAGG - Intronic
1121714330 14:96062217-96062239 CCTAGTGGGCAGACTGTGGAAGG - Intronic
1121882660 14:97514719-97514741 CTTTGGGAGGAGACATTGGAAGG + Intergenic
1122152820 14:99734012-99734034 ACTTGGAGCCAGACACAGGAAGG + Intergenic
1122232604 14:100314201-100314223 CGTGTGGCGCAGACACTGGAGGG - Intergenic
1122266022 14:100547247-100547269 CCATGGTGGCAGACACTGCCCGG - Intronic
1122890500 14:104729996-104730018 CCTTGGAGGCAGCCAGGGGAGGG - Exonic
1124230921 15:27945521-27945543 TCTTGGGGGCAGGCTCAGGAAGG - Intronic
1124365555 15:29068714-29068736 CCTGGGTGTCAGTCACTGGAGGG + Intronic
1124963406 15:34414929-34414951 CCTGGGTGTCAGTCACTGGAGGG + Intronic
1124980027 15:34561155-34561177 CCTGGGTGTCAGTCACTGGAGGG + Intronic
1129003086 15:72350119-72350141 TGTTGGGGGCTCACACTGGAGGG + Intronic
1129056771 15:72826010-72826032 CCCTGGGGGCTGACACAGGCAGG + Intergenic
1132414752 15:101612294-101612316 CCTTGGGTGCAGCCACTTGTCGG + Intergenic
1132598662 16:764398-764420 CCCTTGGGGCAGAGCCTGGAGGG - Intronic
1132696957 16:1206313-1206335 CCCTGGGGTGAGACACTGGGCGG - Intronic
1132740254 16:1408490-1408512 CCACGGGGGCAGGCACCGGAGGG + Intronic
1132810275 16:1793835-1793857 CCTGGGGTGCAGACAGTGCAGGG + Intronic
1133235678 16:4386366-4386388 CACTGGGGGCAGAGCCTGGAAGG + Intronic
1133824288 16:9263156-9263178 CTTTGGAGGCAGACGCAGGAGGG - Intergenic
1134072366 16:11268784-11268806 CCTTGGGGGCAGTGAGAGGAAGG - Intronic
1135137411 16:19895281-19895303 CATTGGGGGCAGCAACAGGATGG - Intergenic
1135674881 16:24406856-24406878 CCTTGTGGGCAGAAACTGGAGGG - Intergenic
1135957638 16:26969614-26969636 ACTTGGGGGTAGACTCAGGAGGG - Intergenic
1136022638 16:27449753-27449775 TCCTGGAGGCAGACGCTGGAGGG - Exonic
1136276131 16:29180452-29180474 CCATGGGGGCTGAGACTGGGGGG - Intergenic
1138096807 16:54218456-54218478 CCCTGGTGGCAGTCACTGAATGG + Intergenic
1139400002 16:66673951-66673973 ACTTGGGGGCAAAAACTGGCTGG - Intronic
1139534519 16:67563023-67563045 CCTCGAGGGCAGACAAAGGAAGG - Intronic
1141469874 16:84230963-84230985 GAATGAGGGCAGACACTGGAAGG + Intronic
1141525368 16:84607608-84607630 TGTTGGGGACACACACTGGAGGG + Intronic
1142133913 16:88443021-88443043 CCTCGGGGGCTGACGTTGGAGGG + Intergenic
1142571531 17:878038-878060 CCCTGGGGGCACAGTCTGGAGGG + Intronic
1142811568 17:2397901-2397923 CTTTGGGGGCAGCCTCTGGGTGG - Intronic
1144613999 17:16751888-16751910 CCCTGGGGGCAGACACTGGAGGG - Intronic
1144632757 17:16882387-16882409 CCTTTGGGGCAGTCAATGGTGGG - Intergenic
1144898713 17:18563783-18563805 CCCTGGGGGCAGACACTGGAGGG + Intergenic
1145133662 17:20381940-20381962 CCCTGGGGGCAGACACTGGAGGG - Intergenic
1146492122 17:33291146-33291168 CTTTGGGGGCTGACACTGGAAGG + Intronic
1146848532 17:36201630-36201652 CCTCGGGGCCAGAATCTGGAAGG - Intronic
1147190223 17:38734118-38734140 CCTTAGGGACAGACCCTGGCAGG - Exonic
1147196494 17:38770166-38770188 CCCTGGGGAAAGACACTGGCAGG + Intronic
1149911980 17:60575057-60575079 CCTTGGAGGTGGAGACTGGAGGG + Intronic
1150220192 17:63491667-63491689 CCTTGGGAGCAGCCCCTGCATGG + Intronic
1151745933 17:76011813-76011835 TCTTGGGGGCTGACACTGCCAGG + Exonic
1152235759 17:79137572-79137594 CCCGGGGGGCAGGCAGTGGAGGG - Intronic
1152992376 18:375208-375230 CTTTGGAGGCAGACAGTGTAGGG - Intronic
1153558884 18:6349818-6349840 CTTTGGGAGCAGTCACTGGAAGG + Intronic
1154018933 18:10645512-10645534 CCTGGGAGCCAGACACTGGTAGG - Intergenic
1154185282 18:12177710-12177732 CCTGGGAGCCAGACACTGGTAGG + Intergenic
1154185299 18:12177911-12177933 CCTCGGAGCCAGACACTGGTAGG + Intergenic
1156180771 18:34601441-34601463 CGCTGGGCTCAGACACTGGAAGG - Intronic
1159136036 18:64337887-64337909 GCTTGGGGCCATGCACTGGAAGG + Intergenic
1159780895 18:72659288-72659310 CATTAGGTGTAGACACTGGAAGG + Intergenic
1161105495 19:2441764-2441786 CCCTGGGGGCAGAGACCTGAAGG + Intronic
1161217263 19:3100726-3100748 CAGTGGGGGCACACTCTGGAGGG + Intronic
1161219647 19:3112544-3112566 CCTTTGGGGCAGACACTGTGGGG - Intronic
1161411585 19:4121118-4121140 TGTTGGGGGCACACACTGGTGGG - Intronic
1161544655 19:4872986-4873008 CCCTGGAGACAGACACAGGATGG + Intergenic
1161588253 19:5117215-5117237 CCTCTGGGGCAGACACAGTAAGG + Intronic
1161679412 19:5672215-5672237 CCTTGAGGGCAGGCACTGATTGG - Intergenic
1162087679 19:8258319-8258341 CCTTGTGAGCAGACATTGCATGG + Intronic
1163315220 19:16536563-16536585 CTTTGGGTGCACAAACTGGAGGG - Intronic
1163426027 19:17241503-17241525 GCTTGGGGGCTGACCCAGGATGG - Intronic
1164478357 19:28592345-28592367 CCATTTGAGCAGACACTGGAAGG - Intergenic
1164771414 19:30812256-30812278 CCTTGTGGGCCCCCACTGGAGGG - Intergenic
1166126934 19:40720577-40720599 CCATGGAGGCAGATTCTGGAAGG - Intronic
1166354420 19:42218435-42218457 CCTGGAGGGCAGAGATTGGAAGG - Intronic
1167351680 19:48978919-48978941 CCCAGGGGGCAGGCCCTGGAAGG + Intronic
1168277424 19:55285348-55285370 CCATAGGGGCAGAGGCTGGAGGG + Intronic
925590902 2:5508017-5508039 CTTTCTGGGCAGCCACTGGAAGG - Intergenic
925990421 2:9250147-9250169 CCTTGGGGGCAGAAACTGCCAGG + Intronic
927018019 2:18987705-18987727 GCTTGGGGCCAGACACTAGAGGG + Intergenic
927651127 2:24914314-24914336 CTTTGGTGGCAGAAACAGGACGG - Intronic
927651612 2:24916929-24916951 CTTTGGTGGCAGAAACAGGACGG - Intronic
928293125 2:30057462-30057484 ACATGGCGGCAGACACAGGATGG + Intergenic
929609180 2:43257265-43257287 CAGTGGGAGCAGACACTTGAAGG - Intronic
929943386 2:46352122-46352144 CTTTGGGGTCAGACCCTGAAGGG + Intronic
933328028 2:80863466-80863488 CCCCAGGGGCAGACACTGGAGGG - Intergenic
934159193 2:89232056-89232078 CCGTGGGGGCAGAGACTGTGAGG + Intergenic
934208079 2:89950369-89950391 CCGTGGGGGCAGAGACTGTGAGG - Intergenic
934572489 2:95381815-95381837 CCCTGGGGCCAGTCTCTGGATGG - Intronic
937198628 2:120182096-120182118 ACGTGGGTGCAGACACAGGAAGG - Intergenic
937782962 2:125860335-125860357 ACTTGGGGGCAGAGAGTGGGAGG - Intergenic
938149234 2:128867646-128867668 CCTTGTGGGAAGACAATGAACGG + Intergenic
938364824 2:130726678-130726700 CCTTGGGTGCAGACGCGGGGTGG - Intergenic
938405626 2:131031736-131031758 CCTTGGGGGTAGGCCCTAGAGGG - Intronic
938639945 2:133267165-133267187 CGTTAGGGGCAGACAATAGAAGG - Intronic
938703437 2:133899423-133899445 CCTGAGGGGCAGACATTGCAGGG - Intergenic
941858610 2:170254937-170254959 CTCCTGGGGCAGACACTGGAGGG + Intronic
948470278 2:238173113-238173135 CTTTGGGGGCAGATCCTGAAGGG - Intronic
948783716 2:240340257-240340279 CATCCCGGGCAGACACTGGAAGG - Intergenic
1172274058 20:33670271-33670293 CCCTGGGAGCAGGCACGGGAAGG + Intronic
1172357912 20:34292493-34292515 CCTTCCAGGCATACACTGGAGGG + Exonic
1172579672 20:36036950-36036972 CCTTGGGGACAGACACTGGAGGG + Intergenic
1174120244 20:48259636-48259658 CCTTTGGGGCAGAGACTGGGAGG - Intergenic
1175221892 20:57421953-57421975 ACTTTGTGCCAGACACTGGACGG - Intergenic
1175585883 20:60139494-60139516 CCTTGGGCAAAGATACTGGAAGG - Intergenic
1176204702 20:63881984-63882006 CCATGTGGGTGGACACTGGAGGG + Intronic
1178029222 21:28505466-28505488 CCTTGGGGGCTAACCCTGCAAGG - Intergenic
1178509003 21:33186580-33186602 CCTTTGGGGGACACACTGGAAGG - Intergenic
1179288535 21:39998202-39998224 CCTTGGGGCCAGTCATTGGGTGG + Intergenic
1179897595 21:44371275-44371297 ACACGGAGGCAGACACTGGAGGG - Intronic
1179897605 21:44371311-44371333 ACACGGAGGCAGACACTGGAGGG - Intronic
1183271938 22:36867769-36867791 CCTTGGGGGCAGACACTGGATGG - Intronic
1183511220 22:38236163-38236185 CCTTGGGGCCAGCCTCTGGGAGG + Intronic
1184152161 22:42645595-42645617 TGTTGGGAGCAGACACTGGAAGG - Intronic
1184904685 22:47473010-47473032 CCTTGGGGGAAGAAACTGGGAGG - Intronic
1184946671 22:47808736-47808758 CCTTGCGGGCAGAGGCTGCACGG + Intergenic
1185169280 22:49283074-49283096 CTTTGGGGGCCGACACTGGCTGG - Intergenic
949544122 3:5057741-5057763 CCGTGGGAGCAGACATTGGATGG + Intergenic
949984935 3:9533086-9533108 CAAAGGGGGCAGGCACTGGAAGG + Intronic
952411982 3:33057636-33057658 CCTTGAGGTCAGCCACTGGCTGG - Intronic
953055459 3:39383994-39384016 CCCTGGGGGCAGGCGCTGTAGGG + Intronic
953667685 3:44937743-44937765 TCTTGGGGGCCCACACAGGATGG - Intronic
954458602 3:50613137-50613159 CCCTGGGGGCACACACTGGGAGG - Intronic
954554412 3:51506726-51506748 GCATGGGGGCAGCCACTGAATGG + Intergenic
954583869 3:51718217-51718239 CTTTGGGGGCAGACATAGGGTGG - Exonic
954688250 3:52382262-52382284 ACTTGGGGCCAGACGCTGAAGGG - Intronic
957446392 3:80317103-80317125 CCTTTGGGGCAGAGACTATAGGG - Intergenic
959090325 3:101895784-101895806 ACTTGGGGGCTGAGACAGGAGGG - Intergenic
961385694 3:126522192-126522214 CTGTGAGGGCAGACACTGCATGG + Intergenic
961645002 3:128388213-128388235 CCTTGGGGACAGCCACAGAAGGG + Intronic
961775217 3:129279276-129279298 CCTCGAGGGCGGCCACTGGACGG - Intronic
962201539 3:133404372-133404394 CCTGGGTGGCAGCAACTGGAGGG + Intronic
962858614 3:139374560-139374582 ACATGTGTGCAGACACTGGAAGG - Exonic
964755669 3:160089032-160089054 ACTAGGGGGTAGACACTGGATGG - Intergenic
966804243 3:183794103-183794125 CTCTGGGGGAAGCCACTGGAGGG + Intronic
967982525 3:195074335-195074357 CCTTGAGAGCAGTCACTGAAGGG + Intronic
968602268 4:1515827-1515849 CCTTGGGGGAAGCCAGTGGCTGG - Intergenic
968811217 4:2800451-2800473 CCCTAGGGGCAGACACCGGCGGG + Intronic
969108686 4:4827905-4827927 CGATGCGGGCAGAGACTGGAGGG + Intergenic
969520500 4:7675356-7675378 CCCTGGGGGCACAGTCTGGAGGG - Intronic
969691213 4:8705265-8705287 CCTAGGGACCAGACACTGGCGGG - Intergenic
971255032 4:25006458-25006480 CTCTGGGGGCTGACACTGGGTGG + Intronic
972022776 4:34335827-34335849 CCTTGGGGGCTGGCACTGCTGGG + Intergenic
972382986 4:38536389-38536411 CTTTGGGGGCAGAGACTGGTCGG + Intergenic
972772039 4:42206423-42206445 ACTTGGGGGAAGTCACTGCATGG + Intergenic
974147609 4:57966787-57966809 CCTTGAGGGCAGAAACTGTGAGG - Intergenic
977492351 4:97731547-97731569 CTTCTGGGGCAGACACCGGAAGG - Intronic
982217125 4:153092075-153092097 CCGTGGAGGCAGAGACTGGAGGG - Intergenic
984465713 4:180098553-180098575 ACTTTGGGGCAGACACTGTGGGG + Intergenic
986133814 5:4955673-4955695 CCTTGGGGGCAAACAAGAGATGG + Intergenic
986234242 5:5892829-5892851 CCTTGGAGCCAGGCACAGGATGG - Intergenic
986588728 5:9346416-9346438 CCATGGGGGCAGACACAAAAGGG + Intronic
988919370 5:35926320-35926342 CCTTGCTGCCAGCCACTGGAGGG - Intronic
989337499 5:40336031-40336053 CAGTGGGTGCAGACAATGGAGGG + Intergenic
990484822 5:56247835-56247857 CCTTCCTGGCAGACTCTGGAGGG + Intergenic
992313244 5:75524739-75524761 CCTTGAGGGCAGGCACAGTAAGG + Intronic
996749997 5:126878753-126878775 CCCAGGGTGAAGACACTGGAAGG - Intronic
997606351 5:135178001-135178023 CCATGGGGACACACACAGGAAGG - Intronic
1000205398 5:159053140-159053162 CTTTGGGGTCAGACACTGCAAGG + Intronic
1001335431 5:170792646-170792668 CTTTGAGGGCACACCCTGGAAGG - Intronic
1002160728 5:177312555-177312577 GCTTGGGGACAGACCCCGGAGGG - Intronic
1003245460 6:4378573-4378595 CCTTGGGGATAGACACTAGCAGG - Intergenic
1010710945 6:79173524-79173546 CCATGGAGGCAGAGATTGGAGGG + Intergenic
1014780608 6:125560359-125560381 TTTTGGGTGAAGACACTGGATGG + Intergenic
1015067052 6:129042660-129042682 GCTTGGGGGCAGAGACTGACTGG - Intronic
1015402278 6:132799916-132799938 ACTTGAGGGCAGAGTCTGGATGG - Intergenic
1017620548 6:156292177-156292199 CCTTGTGAGCAGACAGAGGAAGG + Intergenic
1019987449 7:4668134-4668156 CTTGAGGGGCAGACTCTGGAAGG - Intergenic
1020013486 7:4818476-4818498 CCTGTGGGGCAGGCACTGGGGGG - Intronic
1023817591 7:43962282-43962304 CCTTGAGTGCAGAGACAGGAAGG - Intergenic
1023967558 7:44970809-44970831 CTTTGGGGGCAGGCACAGGGAGG - Intronic
1024454196 7:49584377-49584399 ACATGGAGGCAGAGACTGGAGGG + Intergenic
1024573643 7:50746774-50746796 CCCGGGGGGCAGAGACTGGGTGG - Intronic
1028232299 7:88319981-88320003 GGTTGCTGGCAGACACTGGAAGG + Intergenic
1029742215 7:102497156-102497178 CCTTGAGTGCAGAGACAGGAAGG - Intronic
1029760205 7:102596321-102596343 CCTTGAGTGCAGAGACAGGAAGG - Intronic
1030976021 7:116124228-116124250 CTTTGGGTGCAGACAGTGAAAGG + Intronic
1033770892 7:144550136-144550158 TTTTGGGGGCAGAGAGTGGAGGG + Intronic
1035459625 7:159030935-159030957 CCTTGGGGGCAGAGGCTGGAGGG + Intronic
1037858007 8:22385345-22385367 CCAGGAGGGCAGAGACTGGAGGG - Intronic
1037880073 8:22568992-22569014 CCCTGGGGGCAGCCACGGGTGGG - Intronic
1037969973 8:23164798-23164820 ACTTGGGGACAGACTTTGGAAGG - Intergenic
1038583596 8:28770696-28770718 CCTTGGGGGCTGGAACCGGAGGG - Intronic
1041560808 8:59215730-59215752 TGTCTGGGGCAGACACTGGAGGG - Intergenic
1048017322 8:130509102-130509124 TCCTGGAGGCAGAGACTGGAGGG - Intergenic
1048255318 8:132901130-132901152 GCTTGAGGGCAGGCAGTGGAGGG + Intronic
1048290190 8:133175280-133175302 CCTATGTGCCAGACACTGGAAGG - Intergenic
1048849268 8:138629230-138629252 CCTGGGAGGCAGAGACTGCAGGG - Intronic
1049614175 8:143569064-143569086 CCTGGGAGGGAGAAACTGGAGGG + Intronic
1049614262 8:143569289-143569311 CCTGGGAGGGAGAGACTGGAAGG + Intronic
1049614294 8:143569364-143569386 CCTGGGAGGGAGAGACTGGAAGG + Intronic
1050264100 9:3871739-3871761 CCTTGGGGCCTGTGACTGGAGGG + Intronic
1052031231 9:23631225-23631247 ACTTGGAGGCAGACACTGCGAGG - Intergenic
1052938141 9:34110605-34110627 CCTCGGGGCCAGACTTTGGAAGG + Intronic
1056765154 9:89440513-89440535 CCTTGGGGGCTGAGTGTGGAGGG - Intronic
1057968550 9:99530061-99530083 CCTTGGGGACAGCCACCGGGAGG - Intergenic
1058995143 9:110292244-110292266 CCTGGGGAGCAGGCAGTGGATGG - Intergenic
1059420495 9:114187555-114187577 CCTTGAGGTCAGACAGTTGAGGG - Intronic
1059536336 9:115084458-115084480 CTTTGGGAGGAGACACTGGCAGG + Exonic
1059622714 9:116025762-116025784 GCTTTTGGGCAGACACTGCAGGG + Intergenic
1060813059 9:126620676-126620698 CCTTGGGGGCAGACGGAGGGTGG + Intronic
1061005486 9:127926743-127926765 GCTTGGGGGCAGCCAATGGCCGG + Intronic
1061418583 9:130461374-130461396 CCTTGGGGGCCGACAAAGGCGGG + Intronic
1061590673 9:131595611-131595633 CCTTGAGGGCAGGCAGTGAAGGG + Intronic
1061864398 9:133484998-133485020 GCTTGGGGGCAGGATCTGGAGGG + Intergenic
1062008108 9:134251694-134251716 CCTGGGTTGCAGACACGGGAAGG - Intergenic
1062102809 9:134737374-134737396 CGTGGGGAGCAGACACTTGAGGG + Intronic
1062272291 9:135714998-135715020 GGTTGGGAGCAGACACCGGAAGG - Intronic
1062307767 9:135919475-135919497 CCATGGGGGCACCCGCTGGAGGG - Intergenic
1062707010 9:137951334-137951356 CCAGGCTGGCAGACACTGGAGGG + Intronic
1185472822 X:394888-394910 CCATGGAGGCAGAAAGTGGATGG - Intergenic
1189576563 X:42359800-42359822 CCATAGAGGCAGAGACTGGAGGG - Intergenic
1195899765 X:109785541-109785563 CCTTGAGGGAATACACTAGAGGG - Intergenic
1200062687 X:153490603-153490625 CCTCGGGGGCAGACACCAGTGGG - Intronic