ID: 1183273026

View in Genome Browser
Species Human (GRCh38)
Location 22:36873728-36873750
Sequence TGCTCAGGACAACCCCACAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183273026_1183273030 4 Left 1183273026 22:36873728-36873750 CCCTTGTGGGGTTGTCCTGAGCA 0: 1
1: 0
2: 2
3: 7
4: 118
Right 1183273030 22:36873755-36873777 AGGCTGTTCAGCAATATCCCTGG 0: 1
1: 2
2: 19
3: 210
4: 698

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183273026 Original CRISPR TGCTCAGGACAACCCCACAA GGG (reversed) Intronic
900612276 1:3549188-3549210 AGCCCAGAACAAGCCCACAAGGG + Intronic
902278638 1:15358415-15358437 TGCTCAGGACAGCCCCTGACAGG - Intronic
906033048 1:42735411-42735433 TCCTCACAGCAACCCCACAAGGG - Intronic
906677612 1:47704436-47704458 TTCTCAGGACAGCCCCAAGAGGG - Intergenic
906800041 1:48729180-48729202 TACTCAGAACAACCCCATACAGG - Intronic
908407013 1:63824594-63824616 TGCTACAAACAACCCCACAATGG + Intronic
915534137 1:156524492-156524514 TCCTCACAACAACCCTACAAAGG - Intergenic
921049915 1:211503990-211504012 TGCTCACAACAACCCTACAAAGG - Intergenic
921165639 1:212504928-212504950 TCCTCATGACAACCCCAAGAGGG + Intergenic
921608219 1:217179676-217179698 TGCTCAGGTCACCCACACAGAGG + Intergenic
1064347159 10:14542471-14542493 TTCTCATGTTAACCCCACAAAGG + Intronic
1067111710 10:43406060-43406082 TGCTCAGGACTACTCCAGAAGGG - Intronic
1068030645 10:51700262-51700284 TGCTCAGGAAAAACCTAGAAGGG - Intronic
1070375794 10:75830162-75830184 TGCTCACAACAGCCCCTCAAGGG - Intronic
1070425528 10:76283646-76283668 TCCTCATAACAACCCCAGAAAGG + Intronic
1072218932 10:93311230-93311252 TGCTCATGGCAACCCTACAAAGG + Intronic
1073599055 10:104829026-104829048 TGGTCAGGACATCCTCACAGTGG - Intronic
1075461658 10:122620533-122620555 TGCTCAGGACAAGCCCTGGAGGG + Intronic
1076431791 10:130409108-130409130 TGCTCAGGAGAAATCTACAAAGG - Intergenic
1077160917 11:1112571-1112593 GGCCCAGGACAGCCCCCCAAAGG + Intergenic
1079173514 11:18118353-18118375 TCCTCACAACAACCCTACAAGGG - Intronic
1083993644 11:66261487-66261509 GGATCAGGAGAACCCCAAAAGGG - Intronic
1084680527 11:70663785-70663807 TGCTCAGGGCCACCAAACAAGGG + Intronic
1085190170 11:74613623-74613645 TTATCAATACAACCCCACAAAGG - Intronic
1087094705 11:94307578-94307600 TGCTCAGGGCAACCCCAATGTGG + Intronic
1090325080 11:125879088-125879110 TTCTCATCACAACCCTACAAAGG + Intergenic
1090804485 11:130194344-130194366 AGCTCAGGTCACCCCCACTAAGG - Intronic
1092101781 12:5889534-5889556 AAATCAGGACAACTCCACAAAGG + Intronic
1098036056 12:66302845-66302867 TGCTCAGGGCAAAGCCAGAATGG - Intronic
1101825902 12:108219757-108219779 TACCCAGGACAACCCCAAAGGGG + Intronic
1108395093 13:49984087-49984109 TCCTCACAGCAACCCCACAAGGG - Intergenic
1109619577 13:64885291-64885313 TGCTCAAGTAAACCCCTCAATGG + Intergenic
1112072723 13:95872942-95872964 TCCTTAGCAAAACCCCACAAGGG + Intronic
1112397274 13:99044494-99044516 TGATCAGGACCACCACACCATGG + Intronic
1112975455 13:105312461-105312483 TTCTCATGACAACCCCATACAGG - Intergenic
1115189897 14:30736805-30736827 TGTTCAGGACAAACACAAAATGG + Intergenic
1118299800 14:64605142-64605164 GGCTCAGAAAAACCACACAAAGG - Intergenic
1118688212 14:68312945-68312967 TACTCAAGACAACCCAACCAAGG - Intronic
1119542933 14:75452487-75452509 TTCTGAGGACAAGCCCACTAGGG + Intronic
1121329573 14:93041441-93041463 TGCTCAGGTCAGCCCCAGGAAGG - Intronic
1122694317 14:103545435-103545457 TGCTGATGACGACCCCACCAAGG + Intergenic
1126786982 15:52185389-52185411 TTCTCTTGACAACCCCAGAAGGG - Intronic
1128379723 15:67103691-67103713 TGCTTAGGAAAACCGCACAGGGG - Intronic
1135545858 16:23365996-23366018 TTCTCAAAATAACCCCACAAGGG - Intronic
1136363041 16:29793712-29793734 TGCACAGGACAGCCCCACAACGG + Intronic
1138497798 16:57418902-57418924 TGCTCAGGTGAATTCCACAAGGG + Intergenic
1140961002 16:79912842-79912864 TTCTCACAACAACCCCACGAGGG - Intergenic
1141664452 16:85458644-85458666 TTCCCAGGACAACCCCACTTTGG - Intergenic
1144508446 17:15854719-15854741 TGCTTTGGAAAACCTCACAATGG + Intergenic
1144961750 17:19048207-19048229 TGCTCATAACAAACCCACTAAGG - Intergenic
1144973411 17:19126315-19126337 TGCTCATAACAAACCCACTAAGG + Intergenic
1145172570 17:20672360-20672382 TGCTTTGGAAAACCTCACAATGG + Intergenic
1149556458 17:57576911-57576933 TGCTAAGGACGCCACCACAAAGG + Intronic
1149668012 17:58379633-58379655 GGGTCAGGAGAACCCCACCATGG - Intronic
1151455433 17:74222884-74222906 GGCACAGGACAAACCCACATTGG - Intronic
1151559755 17:74863995-74864017 TGCTGAGCACCAGCCCACAAGGG + Exonic
1152019266 17:77771974-77771996 GGCACAAGACAACCCCAGAATGG + Intergenic
1157391511 18:47307251-47307273 CCCTCAGAACAACCTCACAATGG - Intergenic
1158825034 18:61209014-61209036 TGCTGATGACAACACCGCAAAGG + Intergenic
1160313580 18:77820567-77820589 TGCACAGCACAACCACACAGAGG + Intergenic
1160834448 19:1117966-1117988 TGCTCAGGACGGCCCCACCCCGG + Intronic
1161461325 19:4399612-4399634 TGCCCAGGACGGCCCCACCACGG + Intronic
1161517916 19:4706897-4706919 TGGTCAGGACAGCCCCACCCCGG - Intronic
1163411551 19:17158089-17158111 CGCACAGGACAGCCCCCCAATGG + Intronic
1163419749 19:17207272-17207294 TGCTCAGGGCAGCCCCACCCAGG + Intronic
1163430903 19:17267005-17267027 TGCTCAGGCCACACCCACATGGG + Intronic
1165559527 19:36667116-36667138 TTCTCACCACAACTCCACAAAGG - Intergenic
925040698 2:731468-731490 CGGTCCGGACAACTCCACAAGGG - Intergenic
929815685 2:45229513-45229535 TGCTGAAGACAACCACAAAATGG + Intergenic
932899932 2:75685923-75685945 TGCTCAGGCCAATTCCTCAATGG + Intronic
933714727 2:85351597-85351619 TGCTCAGTATCACCCCACAAGGG + Intronic
940246243 2:151619926-151619948 TCCACAGAATAACCCCACAATGG + Intronic
942346473 2:175007639-175007661 CTCCCAGGACAACCCCTCAAGGG - Intergenic
943719011 2:191183260-191183282 TGCTCGGGTCATCCCCACAGAGG - Intergenic
948058327 2:235026080-235026102 TGCTGAGAACAACCCTACAGAGG + Intronic
948316216 2:237030374-237030396 TGACCAGGACAGCCCCCCAAAGG - Intergenic
948837311 2:240631990-240632012 TGCCCAGGAGAGCCCCATAAGGG + Intergenic
1170539220 20:17371173-17371195 TGCATAGCATAACCCCACAAAGG + Intronic
1171306740 20:24113082-24113104 CGCACAGAACAACCCCGCAAAGG - Intergenic
1175162460 20:57019144-57019166 TGCACAGGACAGCCCCACAGCGG - Intergenic
1175205755 20:57309941-57309963 TGCTCCCCACCACCCCACAAAGG + Intergenic
1179888315 21:44323956-44323978 GGCTCAGCCCCACCCCACAAGGG - Intronic
1180069845 21:45430801-45430823 TTCCCAGGGCAGCCCCACAAAGG - Intronic
1181266069 22:21631742-21631764 TGCTCAGTAATACCCCACCATGG - Intergenic
1183273026 22:36873728-36873750 TGCTCAGGACAACCCCACAAGGG - Intronic
950127514 3:10519054-10519076 TTCTTACAACAACCCCACAAGGG + Intronic
950541409 3:13615391-13615413 TGCCCAGGACAAATCCACAGGGG - Intronic
955103033 3:55870511-55870533 TGCTCAGAAGAATCCCACAGGGG + Intronic
959227434 3:103603512-103603534 TGCTCTTAACAACCCCAGAAAGG - Intergenic
963777065 3:149450453-149450475 TTCTCAAAACAACCACACAAAGG - Intergenic
966750132 3:183313932-183313954 TGCTCAGGGCACACGCACAACGG - Intronic
966774782 3:183534311-183534333 TGCTCTGGACACTCCAACAAAGG - Intronic
970466241 4:16325905-16325927 TACCCTGGAGAACCCCACAAAGG + Intergenic
972485887 4:39540271-39540293 TGCTGAGGACAACACAACAGAGG + Intergenic
977666574 4:99651588-99651610 TGCTCAGGCCACCTCCACAGCGG - Exonic
980574608 4:134668730-134668752 TACTCAAAACAACCTCACAAGGG + Intergenic
986267246 5:6201263-6201285 TGCTCAGGATAAGCCTAGAATGG - Intergenic
990107838 5:52286535-52286557 TGCTCAGGTCTACCACACAGTGG + Intergenic
997877737 5:137564401-137564423 GGCTCAGGACATCCATACAAAGG + Intronic
999109192 5:149102815-149102837 TGCTCAGAACAATCAGACAAGGG + Intergenic
999981943 5:156966308-156966330 TGCTCAGGAATAATCCACAAAGG + Intergenic
1005022243 6:21429514-21429536 CACACAGGACAACCCCAAAAGGG + Intergenic
1007684511 6:43657262-43657284 TTCTCAGGAACACCCAACAAGGG - Intronic
1012372005 6:98518802-98518824 CGCTGAGGACAAAGCCACAAGGG + Intergenic
1021879122 7:25076776-25076798 TCCCCAGAACAAGCCCACAATGG - Intergenic
1025255852 7:57383558-57383580 AGCACAGAACAGCCCCACAATGG + Intergenic
1029102960 7:98149149-98149171 TCCTCAGGACAACCCCAGTTAGG + Intronic
1029408502 7:100392463-100392485 TCATCAGGACAACCCCACGTAGG - Intronic
1029586089 7:101472545-101472567 TGCTTAGCACAACCCCTCCATGG - Intronic
1030977185 7:116141490-116141512 TGCTCAGTACAACTGGACAAAGG + Intronic
1031009854 7:116514499-116514521 TGCTTAGGATAACCCCACATAGG - Intergenic
1035396154 7:158536430-158536452 GACTCAGGAAGACCCCACAAGGG + Intronic
1045485572 8:102628383-102628405 TGCTGGGGCCAGCCCCACAACGG + Intergenic
1047243359 8:123115413-123115435 TACTCAGAACAACCCCAGGAGGG - Intronic
1049025369 8:139984655-139984677 TGCTCTGCACAACCCCTCCACGG + Intronic
1049217314 8:141414237-141414259 TGGACAGGACAGCTCCACAATGG - Intronic
1050982083 9:12032757-12032779 TGCTCAGGAAAAACCTACATTGG - Intergenic
1052351339 9:27461368-27461390 CCCACAGGACAACCCCAGAATGG + Intronic
1053036309 9:34829539-34829561 TGGTCAGGAGAATCCCAGAAGGG - Intergenic
1057899847 9:98940010-98940032 TTCTCATCACAACTCCACAAGGG + Intergenic
1061311270 9:129764277-129764299 AGCTCAGGACGACTCGACAAAGG + Intergenic
1061537095 9:131256981-131257003 TCCTCATGACAACCCCACAAGGG - Intergenic
1185552793 X:997489-997511 TGCCCAGGACAGCCCCACCGCGG + Intergenic
1186213842 X:7278678-7278700 TTCTCAGTACAACCACACAAGGG + Intronic
1186951306 X:14628658-14628680 GGCAGAGGACAACCCCAGAAAGG + Intronic
1189033808 X:37476032-37476054 AGCTCAGGTCCATCCCACAATGG - Intronic
1189363364 X:40370192-40370214 TCCTCAGAATAACCCCACGAGGG + Intergenic
1190453347 X:50602390-50602412 TCCTTAGAACAACCCAACAAGGG - Intronic