ID: 1183276828

View in Genome Browser
Species Human (GRCh38)
Location 22:36903723-36903745
Sequence CTCCCAGTAGGTGTTTAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183276818_1183276828 30 Left 1183276818 22:36903670-36903692 CCTCATTTTTTCTGGTCACCACT No data
Right 1183276828 22:36903723-36903745 CTCCCAGTAGGTGTTTAGAAGGG No data
1183276825_1183276828 -6 Left 1183276825 22:36903706-36903728 CCAGAGCAAGGGCTTGGCTCCCA No data
Right 1183276828 22:36903723-36903745 CTCCCAGTAGGTGTTTAGAAGGG No data
1183276822_1183276828 3 Left 1183276822 22:36903697-36903719 CCTAAGTGCCCAGAGCAAGGGCT No data
Right 1183276828 22:36903723-36903745 CTCCCAGTAGGTGTTTAGAAGGG No data
1183276819_1183276828 12 Left 1183276819 22:36903688-36903710 CCACTATGTCCTAAGTGCCCAGA No data
Right 1183276828 22:36903723-36903745 CTCCCAGTAGGTGTTTAGAAGGG No data
1183276824_1183276828 -5 Left 1183276824 22:36903705-36903727 CCCAGAGCAAGGGCTTGGCTCCC No data
Right 1183276828 22:36903723-36903745 CTCCCAGTAGGTGTTTAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183276828 Original CRISPR CTCCCAGTAGGTGTTTAGAA GGG Intergenic
No off target data available for this crispr