ID: 1183277000

View in Genome Browser
Species Human (GRCh38)
Location 22:36904809-36904831
Sequence TTCCCAGGTAAGACCCATAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183276997_1183277000 26 Left 1183276997 22:36904760-36904782 CCACTTAGATATGGTAACATTGA No data
Right 1183277000 22:36904809-36904831 TTCCCAGGTAAGACCCATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183277000 Original CRISPR TTCCCAGGTAAGACCCATAG AGG Intergenic
No off target data available for this crispr