ID: 1183277825

View in Genome Browser
Species Human (GRCh38)
Location 22:36912327-36912349
Sequence AACCCTGCAGGGGCTTCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183277825_1183277829 -10 Left 1183277825 22:36912327-36912349 CCTGGAGAAGCCCCTGCAGGGTT No data
Right 1183277829 22:36912340-36912362 CTGCAGGGTTTTTCCATGCCAGG No data
1183277825_1183277830 -6 Left 1183277825 22:36912327-36912349 CCTGGAGAAGCCCCTGCAGGGTT No data
Right 1183277830 22:36912344-36912366 AGGGTTTTTCCATGCCAGGCAGG No data
1183277825_1183277831 -5 Left 1183277825 22:36912327-36912349 CCTGGAGAAGCCCCTGCAGGGTT No data
Right 1183277831 22:36912345-36912367 GGGTTTTTCCATGCCAGGCAGGG No data
1183277825_1183277834 11 Left 1183277825 22:36912327-36912349 CCTGGAGAAGCCCCTGCAGGGTT No data
Right 1183277834 22:36912361-36912383 GGCAGGGACCTCACACTGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183277825 Original CRISPR AACCCTGCAGGGGCTTCTCC AGG (reversed) Intergenic