ID: 1183278539

View in Genome Browser
Species Human (GRCh38)
Location 22:36918380-36918402
Sequence GAATGCAACAAGGGTCAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 114}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183278539_1183278545 16 Left 1183278539 22:36918380-36918402 CCAATCTGACCCTTGTTGCATTC 0: 1
1: 0
2: 0
3: 8
4: 114
Right 1183278545 22:36918419-36918441 TTTCTTCTGGAAGCATTTCTGGG 0: 1
1: 0
2: 4
3: 40
4: 443
1183278539_1183278542 3 Left 1183278539 22:36918380-36918402 CCAATCTGACCCTTGTTGCATTC 0: 1
1: 0
2: 0
3: 8
4: 114
Right 1183278542 22:36918406-36918428 GTATCCTATTTGTTTTCTTCTGG 0: 1
1: 0
2: 1
3: 38
4: 360
1183278539_1183278544 15 Left 1183278539 22:36918380-36918402 CCAATCTGACCCTTGTTGCATTC 0: 1
1: 0
2: 0
3: 8
4: 114
Right 1183278544 22:36918418-36918440 TTTTCTTCTGGAAGCATTTCTGG 0: 1
1: 0
2: 1
3: 37
4: 495

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183278539 Original CRISPR GAATGCAACAAGGGTCAGAT TGG (reversed) Intronic
905491908 1:38350996-38351018 GAATGGAGAAAGGGTCAGAGAGG - Intergenic
907708821 1:56858338-56858360 GAATGTAATAAGGGTTAAATTGG - Intronic
908836738 1:68235779-68235801 ACATGAAACAAGGGGCAGATGGG - Intergenic
916720123 1:167478518-167478540 CAGTGGAACACGGGTCAGATTGG + Intronic
917505231 1:175621368-175621390 GGAAGCAAGGAGGGTCAGATGGG - Intronic
918142298 1:181729944-181729966 CAATGCAACAAGGCACAGGTGGG - Intronic
918774182 1:188608213-188608235 GATGGCAGCATGGGTCAGATTGG - Intergenic
919541540 1:198852543-198852565 GAAAGCAACAATGTTCAGGTAGG + Intergenic
923136129 1:231121155-231121177 GAATCCAGCAAAGGTCAGAAGGG + Intergenic
924809875 1:247391571-247391593 GAATGCAACAAGGGAACGTTGGG + Intergenic
1067715873 10:48690987-48691009 GAAGGCAGCAGGGGGCAGATAGG - Intronic
1071334912 10:84592728-84592750 AAATGGAATAAGGGTCAGAGAGG + Intergenic
1072229003 10:93397833-93397855 GACTGGAACAAGAGTCAGTTTGG - Intronic
1074548578 10:114422109-114422131 GAATGAAACAAGTCTGAGATTGG - Intergenic
1074932927 10:118147534-118147556 TAAGGAAACAAGGGTCAGATAGG + Intergenic
1075691688 10:124399994-124400016 TAAAGGAACAAGGGTCAAATTGG + Intronic
1076459985 10:130635658-130635680 GAGTGGAATAAGGGTGAGATAGG - Intergenic
1080716374 11:34805714-34805736 GAAGACAACAAGGCTCAGAGGGG + Intergenic
1080918768 11:36687778-36687800 GAAGGAAACAAGGATAAGATTGG - Intergenic
1085259275 11:75195103-75195125 GAATACAGCAAGGCTCAGAGAGG + Intronic
1086075238 11:82843891-82843913 GAATGCAAGAAGCGTATGATTGG + Intronic
1090227825 11:125082216-125082238 GAGTGCAACAGGGGGCACATGGG - Intronic
1092640382 12:10501479-10501501 GAATTCCAAAAGGATCAGATTGG - Intergenic
1096189819 12:49609178-49609200 AGATGCAACCAGGGTCAGCTTGG + Intronic
1098825296 12:75288912-75288934 GAAAGGACCAAGGATCAGATGGG + Intronic
1101754577 12:107610959-107610981 GAAAGTCACAAGGGACAGATGGG + Intronic
1102520480 12:113475006-113475028 GACTGCAACAAGGGCAGGATTGG - Intergenic
1104603495 12:130169660-130169682 GAATGCAGCAAGGGTCTTACAGG + Intergenic
1109029475 13:57174706-57174728 GGATGCAACAAGTGTCAGTAAGG + Intergenic
1116199529 14:41773162-41773184 GAATGCAAGAAGGGCATGATGGG - Intronic
1118993048 14:70812921-70812943 GAATGCAAAAAGGGAGTGATGGG + Intergenic
1120793371 14:88606352-88606374 AAATGCAATAAGGGACAGACGGG - Intronic
1125802880 15:42465799-42465821 GATTGCAACAAAGGTGAGTTGGG - Intronic
1126242629 15:46462919-46462941 GAATGCAACAAATGCCAAATCGG + Intergenic
1126532091 15:49721658-49721680 TAATGGAAGAAGGGTCAGAGAGG + Intergenic
1128006134 15:64243403-64243425 CAATGTAACAAAGGTCATATAGG + Intronic
1129031422 15:72620715-72620737 GAATGGCACAAGGGACAGGTGGG - Intergenic
1129218517 15:74116722-74116744 GAATGGCACAAGGGACAGGTGGG + Intronic
1129405833 15:75316819-75316841 GAATGGCACAAGGGACAGGTGGG - Intergenic
1130381864 15:83378754-83378776 GAATGCAACAATAGACAGATGGG - Intergenic
1130630522 15:85563547-85563569 GAATGCAACAAGGAGCAAAGAGG - Intronic
1131220733 15:90581978-90582000 GGAGGCCACAAGGGTCAGGTAGG - Intronic
1136140394 16:28284447-28284469 CTATGCAACAAGGATCTGATGGG - Intergenic
1139549531 16:67666037-67666059 GAATGGAAGAAGGGACAGAGAGG - Intronic
1141143573 16:81513662-81513684 CAATGGGGCAAGGGTCAGATGGG + Intronic
1146990432 17:37265950-37265972 GAATGCACCAAGGGACTGAAAGG - Intronic
1147364297 17:39950451-39950473 GAATGAAATAAGGGAGAGATAGG + Intergenic
1151454150 17:74216035-74216057 GAAGGGAACAAGGCTCAGAGAGG - Intronic
1156579160 18:38355352-38355374 CAATGGAACAAGGGGCAGACAGG + Intergenic
1156837938 18:41577967-41577989 GATTCCACCAAGGGTCTGATAGG + Intergenic
1157653968 18:49366873-49366895 GAAGACATCAAGGCTCAGATAGG + Intronic
1159784693 18:72698824-72698846 GGAGGCAAGAAGGGGCAGATGGG + Intergenic
1160111395 18:76035443-76035465 GAATGAAACAAGGGGTAGAAAGG - Intergenic
1160806246 19:993446-993468 GATTGGAACAAGGGTCACAGAGG - Intronic
1161630710 19:5353946-5353968 AAATGTACCACGGGTCAGATGGG + Intergenic
1162403326 19:10459122-10459144 GAAGGCACCAAGGCTCAGAGAGG - Intronic
1166088400 19:40492147-40492169 GGAAGCAACAAGGGGCAGGTGGG + Intronic
1167758592 19:51428752-51428774 GGATGGAACAAAGGTCAGAGAGG + Intergenic
925273496 2:2632054-2632076 GAACAGAACAAGGGTCAGCTAGG - Intergenic
925695687 2:6575813-6575835 GAATGAAAAAGGGGTAAGATGGG + Intergenic
926857910 2:17277180-17277202 GAATGCAACTTGGTGCAGATGGG - Intergenic
929719782 2:44356132-44356154 GAATTCAATAAGGTTTAGATCGG + Intronic
930161739 2:48165508-48165530 GAAAGCAACAAGAGTTAGAAGGG - Intergenic
930996536 2:57726193-57726215 GAATGTAAAAGGGGTCAGAAAGG - Intergenic
934489517 2:94751057-94751079 GAATGTAACAAAAGTCAGAAAGG + Intergenic
934602325 2:95667053-95667075 GAAGGCAACAAGGTTCTGTTGGG + Intergenic
936535688 2:113309207-113309229 GAAGGCAACAAGGTTCTGTTGGG + Intergenic
940586124 2:155653186-155653208 GATTGCCACTAGGGTCAGCTAGG + Intergenic
942616062 2:177793317-177793339 GAATGCCACAAAAGTCAGAGTGG - Intronic
946779637 2:223179768-223179790 GGATGGAACAAGGCTCAGAGAGG + Intronic
1169272799 20:4213583-4213605 GAATGAAGCATGAGTCAGATGGG + Intergenic
1170344093 20:15364214-15364236 GAATGCAGCAAGAGTAAGAAAGG - Intronic
1172997850 20:39083947-39083969 GAATGTGACAAGTGGCAGATGGG + Intergenic
1178407987 21:32340253-32340275 GAATGTATCAAGGGTCAGGAAGG + Intronic
1181969658 22:26680619-26680641 GAATGAAACAAGAGTCAGTTGGG + Intergenic
1183278539 22:36918380-36918402 GAATGCAACAAGGGTCAGATTGG - Intronic
1183648136 22:39138562-39138584 AAATGCACCAAGGGGCAGAGGGG + Intronic
1185396234 22:50591208-50591230 AAATGGAACAAAGGTAAGATGGG - Intronic
949458413 3:4263765-4263787 GAATGGAATAAGGGTCAGAGAGG - Intronic
950878068 3:16296102-16296124 GAACGCAGCAAGGTTCAGTTAGG + Intronic
952061761 3:29519316-29519338 GAATTCAAGAAGGGTTAGAAAGG + Intronic
954065296 3:48101077-48101099 GAATGAAACAATGGGCAGATTGG + Intergenic
955338600 3:58107396-58107418 GAAGACACCAAGAGTCAGATAGG - Intronic
956866884 3:73377909-73377931 GATCGGAATAAGGGTCAGATAGG - Intergenic
957672956 3:83328691-83328713 GAATGAAAAAAGGGGCAGAGAGG + Intergenic
962086937 3:132201156-132201178 GAGTGCAGCAAGGGTCAGAAGGG + Intronic
966654737 3:182342959-182342981 GCATGCATCAAGGGCCAGTTGGG - Intergenic
968610551 4:1554922-1554944 GAGTGGATCAAGGGTCAGAGTGG - Intergenic
972943279 4:44223039-44223061 GAATGCAAGAAGGGCAATATTGG + Intronic
979913725 4:126404403-126404425 TAATGCAACCAGGGCCAGCTTGG + Intergenic
984360870 4:178730170-178730192 TGGTGCAACAAGGATCAGATTGG + Intergenic
985924694 5:3006634-3006656 GACTGAGACAAGGGTCAGCTTGG + Intergenic
989694908 5:44189291-44189313 TAATGGAACAAGGGTCATACAGG + Intergenic
990150616 5:52813498-52813520 GAAGGCAAAGAGGCTCAGATAGG + Intronic
991278318 5:64878984-64879006 GAATGGAAGAAAGGTCAGACTGG + Intronic
996177150 5:120372919-120372941 ATAGGCAACAAGGGGCAGATAGG + Intergenic
1000898935 5:166889916-166889938 ACATGCAACAAAGGTAAGATTGG + Intergenic
1009530793 6:64811682-64811704 GAATGCAAGAAGGACCAGACAGG - Intronic
1011281392 6:85681277-85681299 AAATGTAAAAAGGATCAGATGGG + Intergenic
1013085447 6:106853008-106853030 GAATTCAACATGGGTTAAATAGG - Intergenic
1015974102 6:138772010-138772032 AAATGCTACAGGGCTCAGATGGG + Intronic
1016904363 6:149134188-149134210 GAATGGAAAAAGGGACAGACTGG + Intergenic
1017622491 6:156313752-156313774 GAATGTAAGAAGGATCAGAATGG + Intergenic
1025993624 7:66514166-66514188 GACTGCAAGAGGGGTCAGCTCGG - Intergenic
1026847689 7:73706928-73706950 GAAGGCAAAATGGGTCAGGTGGG - Intronic
1028532447 7:91852351-91852373 CAATGCAACTAGGGTGTGATAGG + Intronic
1028698542 7:93747382-93747404 GAATGGAGCAAGAGTGAGATGGG - Intronic
1030008269 7:105139815-105139837 GAATGAACCAAGGCTCAGACAGG + Intronic
1031205371 7:118750654-118750676 GAAGGCGTCAAGGGTCAGCTGGG - Intergenic
1035908909 8:3543964-3543986 GAAAGCAGAAAGAGTCAGATAGG + Intronic
1039731065 8:40278911-40278933 CAATGACACAAGGGTCAGAAGGG - Intergenic
1039919397 8:41882685-41882707 GCATGAAACCAGGGTCAGACAGG - Intronic
1041177871 8:55215509-55215531 GAATCCAACTAGGATCAAATTGG + Intronic
1041210863 8:55549640-55549662 GAATCCAAACAGGGTCAGAGAGG + Intergenic
1041977284 8:63814516-63814538 GCATTCAACAAGGATGAGATGGG + Intergenic
1045595459 8:103650203-103650225 GAAGGCAACTAGGGTCTGAAGGG - Intronic
1048169013 8:132087348-132087370 GAAGGCAACAGGGGGCAGACAGG + Intronic
1057458424 9:95235867-95235889 AAAAGCAACAAGGGGCACATGGG + Intronic
1059103842 9:111494562-111494584 AAATGGAAGAAGGTTCAGATAGG - Intergenic
1059194909 9:112361889-112361911 GAAAGTAACAAGTGTCGGATGGG - Intergenic
1189956373 X:46278658-46278680 GAAAGCAAGAAGGGTAAGATAGG - Intergenic
1195710998 X:107773878-107773900 GAATGCAAGCAGGCTCAAATAGG - Intronic
1198921835 X:141737711-141737733 GAAAGCAGCAAGGGCCAGATTGG + Intergenic