ID: 1183279149

View in Genome Browser
Species Human (GRCh38)
Location 22:36922904-36922926
Sequence CAGGCTGCACAGTCGGTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183279139_1183279149 2 Left 1183279139 22:36922879-36922901 CCAGGGCTGAGTGTGTGCCCCCT 0: 1
1: 0
2: 6
3: 22
4: 247
Right 1183279149 22:36922904-36922926 CAGGCTGCACAGTCGGTCCAGGG No data
1183279138_1183279149 3 Left 1183279138 22:36922878-36922900 CCCAGGGCTGAGTGTGTGCCCCC No data
Right 1183279149 22:36922904-36922926 CAGGCTGCACAGTCGGTCCAGGG No data
1183279137_1183279149 14 Left 1183279137 22:36922867-36922889 CCACGCTGCATCCCAGGGCTGAG 0: 1
1: 1
2: 2
3: 34
4: 315
Right 1183279149 22:36922904-36922926 CAGGCTGCACAGTCGGTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183279149 Original CRISPR CAGGCTGCACAGTCGGTCCA GGG Intronic
No off target data available for this crispr