ID: 1183280872

View in Genome Browser
Species Human (GRCh38)
Location 22:36931740-36931762
Sequence TTGTGGGTCTGCCGGCCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183280862_1183280872 19 Left 1183280862 22:36931698-36931720 CCTGCCCAGTTTCTGCTTTCTTT No data
Right 1183280872 22:36931740-36931762 TTGTGGGTCTGCCGGCCAGGTGG No data
1183280864_1183280872 14 Left 1183280864 22:36931703-36931725 CCAGTTTCTGCTTTCTTTACCCT 0: 1
1: 1
2: 9
3: 63
4: 579
Right 1183280872 22:36931740-36931762 TTGTGGGTCTGCCGGCCAGGTGG No data
1183280861_1183280872 20 Left 1183280861 22:36931697-36931719 CCCTGCCCAGTTTCTGCTTTCTT 0: 2
1: 0
2: 6
3: 110
4: 1048
Right 1183280872 22:36931740-36931762 TTGTGGGTCTGCCGGCCAGGTGG No data
1183280866_1183280872 -6 Left 1183280866 22:36931723-36931745 CCTTTGCCTCTTTCAAGTTGTGG 0: 1
1: 0
2: 4
3: 25
4: 268
Right 1183280872 22:36931740-36931762 TTGTGGGTCTGCCGGCCAGGTGG No data
1183280863_1183280872 15 Left 1183280863 22:36931702-36931724 CCCAGTTTCTGCTTTCTTTACCC 0: 1
1: 0
2: 3
3: 67
4: 436
Right 1183280872 22:36931740-36931762 TTGTGGGTCTGCCGGCCAGGTGG No data
1183280865_1183280872 -5 Left 1183280865 22:36931722-36931744 CCCTTTGCCTCTTTCAAGTTGTG 0: 1
1: 0
2: 1
3: 26
4: 265
Right 1183280872 22:36931740-36931762 TTGTGGGTCTGCCGGCCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183280872 Original CRISPR TTGTGGGTCTGCCGGCCAGG TGG Intronic
No off target data available for this crispr