ID: 1183282378

View in Genome Browser
Species Human (GRCh38)
Location 22:36938506-36938528
Sequence CCCTTGCCTGTCTAGGCCTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 268}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183282378 Original CRISPR CCCTTGCCTGTCTAGGCCTG GGG (reversed) Exonic
900430746 1:2602032-2602054 CCCATGCCTGTGTGTGCCTGTGG - Intronic
900470814 1:2854102-2854124 CCCTGGCCAGCCTGGGCCTGGGG - Intergenic
900692004 1:3986721-3986743 CCTGAGCCTGTCTATGCCTGGGG + Intergenic
901067626 1:6501970-6501992 CCTTTGCATGGCCAGGCCTGTGG - Intronic
901673376 1:10868621-10868643 GCCTTGCCAGTCTAGGCCCAGGG - Intergenic
902157312 1:14498881-14498903 CCCCTTCCTGTTCAGGCCTGGGG + Intergenic
902330873 1:15730730-15730752 CCCTGGCAGCTCTAGGCCTGGGG + Intronic
904213132 1:28898735-28898757 CCCTTGCCCGCCTTGGCCTTGGG + Intronic
904751990 1:32746682-32746704 ACCTTGCCTGTCTGGTCCTCTGG - Intronic
906015243 1:42571144-42571166 CCTTTACCTTTCTTGGCCTGTGG + Intronic
908628396 1:66073559-66073581 CCCTTTCCTTTCTTGGCATGTGG + Intronic
909113786 1:71509374-71509396 CTCTTGCCTCTCTAGGCAGGGGG + Intronic
910093338 1:83491579-83491601 CCCTTGCCTTTCTAGGCAGGTGG + Intergenic
910446088 1:87300155-87300177 CCCTGGCCTCTCCAGGCTTGTGG + Intergenic
911797530 1:102092709-102092731 CCCTTTCCTCTCTACCCCTGGGG - Intergenic
913200072 1:116488780-116488802 CCCTTGCTTTTCTGGGACTGAGG - Intergenic
915577183 1:156787087-156787109 CCCTTGGATGCCTAAGCCTGGGG + Exonic
916675798 1:167063575-167063597 CCCTTACCTGGCTGGGCCAGGGG + Exonic
917463653 1:175255103-175255125 CCCATTCCTATCTATGCCTGAGG - Intergenic
920333156 1:205226892-205226914 CCCTTCACTGTCTAGGCCAGTGG + Intergenic
920892971 1:210011379-210011401 GCCTTGCCTGTCTTGTCCTCAGG - Intronic
921602577 1:217122253-217122275 CCCTTGTCAGCCTAGGCCTCTGG - Intronic
922613331 1:226945771-226945793 CCCGTCCCTGTCTAAGACTGAGG - Intronic
922619007 1:226979353-226979375 CCCGTGCCTGAAGAGGCCTGAGG - Intronic
922689701 1:227678448-227678470 CTCTTGCCTCTCTAGGCAGGAGG + Intergenic
924383266 1:243482529-243482551 CCCCTGCCTGGGTAGGACTGGGG - Intronic
1064341327 10:14488402-14488424 CCCTTGCCTGGCAAGGCTTTAGG - Intergenic
1065408635 10:25396891-25396913 TCCTTGCATTTGTAGGCCTGAGG + Intronic
1065941052 10:30564174-30564196 CTCTTGCCTCTCTAGGCAGGGGG + Intergenic
1066995776 10:42561644-42561666 CCCTTGCCTGGCATGGCCTTAGG - Intergenic
1067066764 10:43108368-43108390 CCCTTGCCTGGCATGGCCTTAGG + Intronic
1067278177 10:44852362-44852384 CCCTTCCCTGTCTGTGCCTGTGG - Intergenic
1067740896 10:48895439-48895461 CCCTTGGCTCTCTGGGCCTGTGG + Intronic
1070420595 10:76232831-76232853 CCCCTGTGTGTCTGGGCCTGGGG + Intronic
1070678645 10:78433444-78433466 CCCTTGTATGGATAGGCCTGGGG - Intergenic
1071298866 10:84241688-84241710 CCCTGGCCTCTCTGGGCCTGTGG - Intergenic
1071403149 10:85298216-85298238 CCCTTGCCTGGATAAGACTGTGG + Intergenic
1071524340 10:86349429-86349451 CCCATGCCTCTGTATGCCTGAGG - Intronic
1071576149 10:86728147-86728169 CCATGGCTTGTCTAGTCCTGAGG + Intronic
1072221553 10:93331575-93331597 CCTTTTCCTGTCTAGACCTCGGG + Intronic
1072641312 10:97213360-97213382 CCCTTTCCTGTCTACCCCTCAGG + Intronic
1072899382 10:99393869-99393891 CCCTTGCCTGGCCTGGCCTGAGG + Exonic
1074212846 10:111353581-111353603 GCCTTCCCAGTCTAGTCCTGGGG + Intergenic
1074256948 10:111812334-111812356 CCATTGCCTGCCTAGCCCTATGG - Intergenic
1074300403 10:112227837-112227859 CTCTTGCCTGTCTGGCCATGAGG + Intergenic
1074382068 10:112989328-112989350 CCCTTTCCTGTCTCTGCCTCTGG + Intronic
1074580170 10:114711676-114711698 CCCTTGCCTCTTTAGGCCTAGGG - Intergenic
1075298531 10:121299619-121299641 CCCTTGCCTCTTTTGGCCTGTGG - Intergenic
1077287372 11:1773540-1773562 CCCAGGCCTGTCCAGCCCTGGGG - Intergenic
1077309629 11:1882585-1882607 GCCTCGCCCGCCTAGGCCTGAGG - Intronic
1078583510 11:12558846-12558868 ACCTTGCCTACCTTGGCCTGTGG - Intergenic
1080314489 11:30934534-30934556 CTCTTGCCTCTCTAGGCAGGGGG - Intronic
1081771523 11:45653040-45653062 CCCTTTGCTGTCTGGTCCTGTGG + Intronic
1083639863 11:64139650-64139672 CCCCTGCCTCTTTAGGCCTTGGG - Intronic
1084174595 11:67416674-67416696 GCCAGGCCTGTCCAGGCCTGGGG + Intronic
1086856388 11:91871297-91871319 GCCTTGCCTTTCTAAGCCTAAGG - Intergenic
1087315191 11:96594006-96594028 CCCTTACCTTTCCTGGCCTGTGG + Intergenic
1087743175 11:101912924-101912946 CCCTTGCCTGGCATGGCCTTAGG - Intronic
1089327016 11:117664217-117664239 CCCTCGCCGGTCTAGGCCTCGGG - Intronic
1089533232 11:119145396-119145418 CCCTTACATGTCTGGGCCTAGGG + Intergenic
1089533877 11:119149265-119149287 CCCTTACCTGCCTCGGGCTGCGG - Exonic
1090232743 11:125120604-125120626 CCCTTGACTGTCTCAACCTGGGG - Intergenic
1090381158 11:126328574-126328596 CCCTGGTCTGCCGAGGCCTGTGG - Intronic
1091098904 11:132851394-132851416 CCCTTGCCTCTCTAGACCTGGGG - Intronic
1091300569 11:134504657-134504679 CCCTTGCTCCTCCAGGCCTGGGG - Intergenic
1091999197 12:5018846-5018868 CCTCTGCTTGTCTAGGCTTGAGG + Intergenic
1093072762 12:14724029-14724051 GCCTCGCCTGTCTGGGCCTATGG - Intergenic
1093313445 12:17619563-17619585 CCCTTGCCTGGCATGGCCTTAGG - Intergenic
1095425996 12:42075233-42075255 CCCTTGCCTGACATGGCCTTAGG - Intergenic
1095942260 12:47735025-47735047 CACTTCCCTGTGAAGGCCTGAGG - Intronic
1096613619 12:52819016-52819038 CCCCTGCCTGTATATGCCTGGGG - Intergenic
1098967187 12:76803406-76803428 CTCTTGCCTCTCTAGGCAAGGGG + Intronic
1101350986 12:103929969-103929991 CCCTTTCCCATCTATGCCTGGGG - Intergenic
1101913229 12:108876573-108876595 CCCTTGCCTGACATGGCCTTAGG - Intronic
1102497122 12:113327394-113327416 CCCATTCCTGTCTAGGCTTGTGG - Intronic
1104363457 12:128155117-128155139 CCCTTGCCCCTCCAGGCCAGGGG + Intergenic
1104384607 12:128339418-128339440 CGCTTGCATATCAAGGCCTGCGG + Intronic
1111208154 13:85039743-85039765 CCCTTGCCTGGCATGGCCTTAGG + Intergenic
1111310037 13:86472357-86472379 CCCTTACCTGCCTAGGCATTTGG + Intergenic
1111586889 13:90292830-90292852 CTCTTGCCTCTCTAGGCAGGGGG + Intergenic
1112339458 13:98540939-98540961 ACCTTGTCTGTGGAGGCCTGGGG - Intronic
1115226985 14:31113369-31113391 CCATTGCCTGCTTTGGCCTGAGG + Exonic
1115514506 14:34172066-34172088 CCCTTGATTGTCCAGCCCTGTGG - Intronic
1119569542 14:75658277-75658299 CCCTTGCCTGGCATGGCCTTAGG - Intronic
1119641564 14:76319021-76319043 CCATTGCCTGTCTGGGCTTTGGG + Intronic
1119927797 14:78512949-78512971 CCCTTACTTCTCTAAGCCTGGGG - Intronic
1120996843 14:90423792-90423814 CTGGTGCCTGTCTAGCCCTGGGG + Intergenic
1121450072 14:94001385-94001407 CCCTTTCCTGCATAGCCCTGGGG + Intergenic
1121595124 14:95156898-95156920 CCCCGGCCTGGCGAGGCCTGGGG - Intronic
1122385120 14:101339650-101339672 CCCTTGCCTGCCACGGCCTCCGG + Intergenic
1122598553 14:102909525-102909547 CCCGTGCCCTTCTTGGCCTGTGG + Exonic
1122794060 14:104196958-104196980 CCCTTGCCTTTCTCAGCCTCTGG - Intergenic
1123401685 15:19993678-19993700 TCCTTGCCTGGCAAGGCCTTAGG - Intergenic
1123429413 15:20202212-20202234 CCCTTGCCTCCTTAGGCCTAAGG + Intergenic
1123511028 15:21000339-21000361 TCCTTGCCTGGCAAGGCCTTAGG - Intergenic
1123899899 15:24865694-24865716 CCCTTGCCTGTCATGGCCTTAGG + Intronic
1123955694 15:25332058-25332080 CCCTAGCATGTCTTGGACTGTGG + Intergenic
1124105795 15:26736821-26736843 CCTCTCCCTGTCCAGGCCTGTGG - Intronic
1124338845 15:28876876-28876898 CCTCTGCCTGGCCAGGCCTGAGG - Intergenic
1124873396 15:33566397-33566419 CCCTTTCAAATCTAGGCCTGAGG + Intronic
1127282100 15:57501525-57501547 CCCATGCCAGGCTATGCCTGGGG - Intronic
1127797649 15:62452192-62452214 CTCCTGTCTGTCTAGGCCTCAGG - Intronic
1129971108 15:79778841-79778863 ACCTTGATTGTCTAGGCCAGTGG - Intergenic
1130686023 15:86038626-86038648 TCCTTTCATGTCTAGTCCTGTGG + Intergenic
1131063894 15:89421140-89421162 CCCTTGCCTGGCTTGGTCTTGGG + Intergenic
1132272652 15:100539907-100539929 CCCTTCCCTTTCTGGTCCTGAGG + Intronic
1132853625 16:2035391-2035413 CCCTGGCCTGGCCTGGCCTGTGG + Intronic
1133316838 16:4890140-4890162 CCCTTGCCAGTGTGTGCCTGGGG + Intronic
1136854910 16:33647517-33647539 CCCTTGCCTCCTTAGGCCTGAGG - Intergenic
1137640396 16:50024038-50024060 CCCTTGCCTGGCAGGGCCTTAGG + Intergenic
1137690409 16:50422972-50422994 TCCTTGCTGGTCTAGGCCTGTGG - Intergenic
1138030107 16:53553027-53553049 TCCTTGCCAGTGTAGGGCTGGGG - Intergenic
1138552277 16:57754350-57754372 CCAATGCCTGTCAAGGCCTGGGG + Intronic
1138587603 16:57981053-57981075 CCCTTGCCTGGCATGGCCTTAGG + Intronic
1140409409 16:74733056-74733078 CTCTTGCCTGTCTGGGGCCGTGG + Intronic
1141177716 16:81731665-81731687 AACTTGCCTGTGGAGGCCTGGGG + Intergenic
1141572172 16:84940839-84940861 GCCTTGCCAGCCTCGGCCTGTGG + Intergenic
1203116486 16_KI270728v1_random:1496002-1496024 CCCTTGCCTCCTTAGGCCTGAGG - Intergenic
1142689833 17:1598831-1598853 CCCTGCCCTGTCCAGGCCTGAGG - Intronic
1143662130 17:8331844-8331866 CCCTTGATTGCCTAGTCCTGGGG + Intergenic
1143996381 17:11009973-11009995 CCCTTGCCTGGCATGGCCTTAGG - Intergenic
1145286476 17:21509895-21509917 CCCTTGCCTGGCATGGCCTTAGG + Intergenic
1145391138 17:22456423-22456445 CCCTTGCCTGGCATGGCCTTAGG - Intergenic
1145392233 17:22464522-22464544 CCCTTGCCTGGCATGGCCTTAGG + Intergenic
1145737123 17:27240781-27240803 CCCCTGCCATTCTGGGCCTGGGG - Intergenic
1146450816 17:32972561-32972583 CTCTTGCCTCTCTAGGCAGGGGG + Intronic
1147245840 17:39120089-39120111 CCCGTGCCTGTCATGGCCTTAGG - Intronic
1147966084 17:44194911-44194933 CCCTTCCCTGTCTGTGCCTGTGG - Intronic
1150839704 17:68596365-68596387 ACCTTGCCTGTCGAGACCAGAGG + Intronic
1152274488 17:79348279-79348301 ACCATGCCTGTCTATACCTGTGG - Intronic
1153963538 18:10160396-10160418 CCCTTGCCTGGCACGGCCTTCGG + Intergenic
1155565688 18:27131748-27131770 CCCTTGCCTTTCATGGCCTTAGG - Intronic
1157582186 18:48780063-48780085 CCGTTGCCTGTCTAGGCTGGAGG + Intronic
1161458234 19:4380703-4380725 CTATTGCCCGTCTAAGCCTGAGG - Intronic
1162057127 19:8071489-8071511 CCCTTCCCTGTCTGAGCCTTGGG - Intronic
1162931714 19:13960886-13960908 CCCCTGCCTGCCTGGCCCTGCGG - Intronic
1162964851 19:14150915-14150937 CCCTGGCCCCTCAAGGCCTGGGG + Exonic
1163730545 19:18946895-18946917 CCCTTTCTTGCCTGGGCCTGAGG - Intergenic
1164957291 19:32397529-32397551 AACTTGCCTGTGGAGGCCTGGGG + Intergenic
1165149259 19:33751345-33751367 CCCTTGGATGTCTACGTCTGAGG - Intronic
1165755748 19:38291799-38291821 CCCTTGCCTGGCCCGTCCTGAGG + Intronic
1166206512 19:41273232-41273254 CCCTGGCCTGGCGAGGCCAGAGG + Intronic
1166697267 19:44859192-44859214 CCCTGGCCTTTCCTGGCCTGGGG + Intronic
1167700850 19:51044569-51044591 CCCTTGCCTGGCATGGCCTCAGG + Intergenic
1168252904 19:55150671-55150693 CCCTTGCCTGGCATGGCCTTAGG - Intergenic
926245539 2:11120262-11120284 CTCTTGCCTGCCCAGTCCTGGGG + Intergenic
927177716 2:20422141-20422163 ACCTTGGCTGACTAGTCCTGTGG + Intergenic
927831760 2:26357604-26357626 TCCTGGCCTGCCTGGGCCTGTGG + Intronic
928103724 2:28454110-28454132 GCCATGCATGTCTGGGCCTGAGG + Intergenic
929094995 2:38254743-38254765 CCCTTGTCTGCCTAGGCATTTGG + Intergenic
930969742 2:57381017-57381039 CCCTTGCCTGGCAAGGCCATAGG - Intergenic
932357390 2:71077739-71077761 CAGTGGCCTGTCTAGGCCTCAGG - Intronic
932792037 2:74662238-74662260 CCCTTGTCTCTCTAGGCCTCTGG + Intronic
933027279 2:77275944-77275966 CCCTTTCCTGTTTAGGCTTCAGG + Intronic
933035731 2:77395063-77395085 CCCTTGCCTGGCATGGCCTTTGG + Intronic
935196572 2:100820010-100820032 CCCTCGCCTGCCTCCGCCTGCGG - Intergenic
935521222 2:104107643-104107665 CCCTTGCCTGGCATGGCCTGAGG + Intergenic
936526541 2:113245431-113245453 CCCTGCCCTGTCCAAGCCTGAGG + Intronic
938144319 2:128821249-128821271 CCCTTGTCTGTCTGGGACTTTGG - Intergenic
938189370 2:129261892-129261914 CCTTTGCCTTGCAAGGCCTGGGG + Intergenic
944417694 2:199495372-199495394 CCCTTGCCTGGCATGGCCTTAGG - Intergenic
945964296 2:216169633-216169655 CCCTTGCCTGGCATGGCCTTAGG + Intronic
948095133 2:235327410-235327432 CCCTTGCCAGGCTAGGGCAGAGG - Intergenic
1169384432 20:5136165-5136187 TCCATGCCTGGCTAGTCCTGTGG + Intronic
1169395555 20:5225860-5225882 CCGGGGCCTGTCTGGGCCTGGGG - Intergenic
1169470205 20:5878483-5878505 CCCTTGCCATTCTAGTTCTGTGG + Intergenic
1172179097 20:32989815-32989837 CCCCTGCCTGTGGAAGCCTGTGG + Intronic
1172303629 20:33866288-33866310 CCCTGGCCTTTCTGGGCTTGTGG + Intergenic
1172639069 20:36430227-36430249 CCCTTGCCTTGCTTGTCCTGAGG + Intronic
1173803566 20:45910146-45910168 CCCTTTCAAGTCCAGGCCTGGGG + Intronic
1173922574 20:46757369-46757391 CCCTTGCCTGAGCAGGCCTCAGG - Intergenic
1175407755 20:58745805-58745827 GCCTTGCCTCTCTAGGGCTTGGG - Intergenic
1175980500 20:62736251-62736273 CCTTTCCCTGTCTGGGTCTGGGG + Intronic
1176284875 21:5014132-5014154 CCCTTGCCTGGCGCGGCCTGAGG + Intergenic
1178840900 21:36136631-36136653 CCCTTGCCTTTCAAGGTATGGGG + Intronic
1179118468 21:38519352-38519374 CCCTTGCCCTTGTAGGCCTGAGG - Intronic
1179173212 21:38989163-38989185 CCCTTACCTGGCGTGGCCTGAGG + Intergenic
1179417569 21:41210431-41210453 CCCTTGCCTGGCGTGACCTGAGG - Intronic
1179872306 21:44249343-44249365 CCCTTGCCTGGCGCGGCCTGAGG - Intronic
1179933756 21:44590161-44590183 CCCTTGCATGTCAACGCCAGAGG - Intronic
1179934549 21:44593711-44593733 CCCTTGCCTGGCGCGGCCTGAGG - Intronic
1180078403 21:45474992-45475014 CCCTGGCCTGTCTTGCCCTCAGG + Intronic
1180851379 22:19023412-19023434 CCCTTGCCTGGAAATGCCTGAGG - Intergenic
1181043491 22:20203943-20203965 CCCTGCCCTGTGGAGGCCTGTGG + Intergenic
1181643486 22:24217346-24217368 CCCCTGCCTGGCTTGGCCTTGGG - Intergenic
1182066330 22:27434117-27434139 CCCTTGCCTGCCCAGGGCTCTGG - Intergenic
1182146228 22:27998498-27998520 CGGGTGCCTGTCAAGGCCTGGGG - Intronic
1182708671 22:32306674-32306696 CCCTTGTCTGGCTGGCCCTGGGG + Intergenic
1183215061 22:36474094-36474116 CCCCTGCCTGGCTATGCCTCGGG - Intronic
1183282378 22:36938506-36938528 CCCTTGCCTGTCTAGGCCTGGGG - Exonic
1183631866 22:39038221-39038243 CCCTTGCCTGGCACGGCCTGAGG - Intergenic
1183636784 22:39068612-39068634 CCCTTGCCTGGCACGGCCTGAGG - Intronic
1183637750 22:39075051-39075073 CCCTTGCCTGGCACGGCCTGAGG - Intronic
1184569338 22:45311849-45311871 CTCTTTCCTGTCTGAGCCTGGGG + Intronic
1184954764 22:47878552-47878574 CCATGGCCAGTCTAGGCCAGCGG - Intergenic
1185061253 22:48607982-48608004 CCCATCCCTCTCCAGGCCTGGGG + Intronic
1185157321 22:49201841-49201863 CCCCAGCCAGTCCAGGCCTGGGG + Intergenic
1185293549 22:50041184-50041206 CACCTGCCTGTCTCGGGCTGTGG + Intronic
949909113 3:8886170-8886192 CCCTTGCCTGGCAAGGCCTTAGG + Intronic
949949978 3:9221078-9221100 CTCTTGCCTGTGTAGAGCTGAGG + Intronic
949980471 3:9499392-9499414 CCCTTGCCTGTGTCACCCTGGGG + Exonic
950426424 3:12927051-12927073 GCCTTGGCTGTAGAGGCCTGGGG - Intronic
952694192 3:36246958-36246980 CCCTTACCTCCCTAGGACTGAGG + Intergenic
953810962 3:46112526-46112548 CTCTTGCCTCTCTAGGCACGTGG - Intergenic
954626724 3:52025896-52025918 CCCATGCCTGTCTAGACCCAGGG - Intergenic
954979810 3:54734955-54734977 ACCTTGCATCCCTAGGCCTGAGG - Intronic
955004134 3:54953704-54953726 CCCTTGCCTGTGAACGCTTGGGG + Intronic
956531296 3:70222138-70222160 CCTTTGCCTGTGTAAGCCTGGGG - Intergenic
958952954 3:100436179-100436201 CCCTTGCCTGGCATGGCCTTAGG + Intronic
959804160 3:110530921-110530943 CCCTTGCCTGGCATGGCCTTAGG - Intergenic
960174767 3:114504014-114504036 CCCCTGTCTGCCTAGGCCAGGGG - Intronic
961218822 3:125183780-125183802 CACTTACCTGTGTGGGCCTGAGG - Intronic
961658818 3:128457653-128457675 CCCCTGCCTGGCCAGGCCTTAGG + Intergenic
961744421 3:129054985-129055007 CCCTTGCCTGGCATGGCCTTAGG + Intergenic
968286967 3:197514409-197514431 CCCTCTCCTGTCCAGGCATGTGG - Exonic
968454008 4:688241-688263 CCCGGGCCTGTCTCGGCCAGAGG + Intronic
968528332 4:1076258-1076280 CCCTTGCTGCTCCAGGCCTGGGG - Intronic
968706349 4:2080216-2080238 TCCTTGCCAGCCAAGGCCTGGGG - Intronic
969552456 4:7879996-7880018 CCCTTGCTTCTTTAGGGCTGTGG - Intronic
969682046 4:8648782-8648804 CACATGCCTGTGTAGGGCTGTGG - Intergenic
971258290 4:25032823-25032845 CCCCAACCTGTCTAGTCCTGAGG - Intergenic
971615376 4:28783123-28783145 CCCTAGCCAGGCTGGGCCTGTGG + Intergenic
972745985 4:41933392-41933414 CCCTTGCCTGGCATGGCCTTAGG + Intergenic
973599721 4:52529889-52529911 TCCTTGCCTTTCTCAGCCTGTGG - Intergenic
976345472 4:83994538-83994560 CCCTTGCCTGGCATGGCCTTAGG - Intergenic
980109671 4:128623187-128623209 AACTTGCCTGTCTTGGCCTGGGG + Intergenic
984312412 4:178079423-178079445 CCCTTGGCTGTTGAGGCCTGAGG - Intergenic
984483564 4:180336923-180336945 ACCTTGCCTGGCAAGGCCTTAGG + Intergenic
984606053 4:181787275-181787297 CCCTTGCCTGGCATGGCCTTAGG - Intergenic
985573679 5:663940-663962 CCCTTGCCTGTCTGCACCTGGGG - Exonic
986207239 5:5636392-5636414 CCCTTGCCTGGCATGGCCTTGGG + Intergenic
986316752 5:6594255-6594277 CCCTTGCCTGGCATGGCCTTGGG - Intergenic
987096843 5:14557810-14557832 CCCTTGCCTGGCATGGCCTTAGG - Intergenic
989102887 5:37837467-37837489 TCCTTGCCTCCCCAGGCCTGGGG - Intronic
991046947 5:62232648-62232670 CCCTTGCCTCCTTAGGCCTGAGG + Intergenic
996655341 5:125927673-125927695 CTCTTGCCTCTCTAGGCAGGGGG + Intergenic
997597031 5:135113769-135113791 CTCTTGCCTGGCTAGGAGTGAGG + Intronic
998060281 5:139113724-139113746 CCCTGGGCTGTCTTGGCCAGTGG + Intronic
999311388 5:150554145-150554167 CCCATGTCTGCCTGGGCCTGAGG - Exonic
999450340 5:151673069-151673091 CCCTTGGCTGCCTGGGCCTGGGG - Intronic
999471496 5:151858737-151858759 GCCTTAACTGTCCAGGCCTGTGG - Intronic
1000234133 5:159341979-159342001 CCCTTGACTGTCTCTGCCTGTGG + Intergenic
1000878763 5:166672065-166672087 CCCTTGCCTGGCAAGGCCTTAGG + Intergenic
1001455591 5:171857677-171857699 CCCTTGCCTGGCTTGTCCTTGGG - Intergenic
1001948850 5:175801930-175801952 CCCTTCCCTCTCTGGGCCTTTGG - Intronic
1002173970 5:177391103-177391125 CCCATCCCTGCCTGGGCCTGGGG - Intronic
1002448597 5:179306620-179306642 CCCTTTCCTGCCCTGGCCTGAGG - Intronic
1005467399 6:26128571-26128593 CCCTTGCCTGAATGGCCCTGGGG + Intronic
1006420889 6:33933275-33933297 CCCTTGCCTGGCATGGCCTTAGG - Intergenic
1006518077 6:34555677-34555699 CCCTTGCCCGGCAAGGCCTGGGG - Intronic
1006990969 6:38214481-38214503 CCCCTGCCTGTCTTGGCATCTGG - Intronic
1007648275 6:43399407-43399429 CTCTTGCCTCTCTAGGCAGGGGG + Intergenic
1008748391 6:54701754-54701776 CACTTGCCTGCCTAGTCCTAAGG - Intergenic
1009537642 6:64909012-64909034 CCCTTATCTGTCTAGGCATTTGG + Intronic
1015747625 6:136526928-136526950 CCCTTGCCTGTCTTCACCAGAGG - Intronic
1016833684 6:148456195-148456217 CCCTTACCAGCCTCGGCCTGGGG - Intronic
1017158327 6:151341944-151341966 GCCTTTCCTTTCTAGGGCTGGGG - Intronic
1018199709 6:161383666-161383688 CCCCTGCCTTTACAGGCCTGGGG + Intronic
1019322736 7:422968-422990 CCCCTTCCTCACTAGGCCTGGGG - Intergenic
1019828713 7:3304502-3304524 TCCTATCCTTTCTAGGCCTGAGG - Intronic
1021522080 7:21548780-21548802 CTCTTGCCTCTCTAGGCAGGGGG - Intronic
1023067598 7:36393936-36393958 CCCTTGCCTGGCATGGCCTTAGG + Intronic
1023652548 7:42387236-42387258 CCTTGGCCTGCCTTGGCCTGGGG + Intergenic
1024659649 7:51480961-51480983 CACTTGCGTGTCTCGGCATGTGG - Intergenic
1024675397 7:51633635-51633657 CCCTTGCCTGGCATGGCCTTAGG + Intergenic
1026841802 7:73673455-73673477 ACTCTGACTGTCTAGGCCTGAGG - Intergenic
1029381738 7:100219707-100219729 CCCAGCCCTGGCTAGGCCTGGGG - Exonic
1030091630 7:105863356-105863378 CCCTTGACTGTGTAAGCCAGTGG - Intronic
1031881923 7:127207848-127207870 CCCTTGCCTGGCATGGCCTTAGG - Intronic
1032185610 7:129722746-129722768 CACTTTCCTGTCAAGGCTTGGGG + Intronic
1032205414 7:129860639-129860661 CCCTTGGCTGTATAGGACTCAGG - Intronic
1032358258 7:131230123-131230145 CCCTTGCCTGGCATGGCCTTGGG + Intronic
1033894246 7:146052526-146052548 CTCTTGCCTCTCTAGGCAGGGGG - Intergenic
1035920383 8:3669739-3669761 CCCTGACCTGGCTAAGCCTGAGG + Intronic
1037815031 8:22107613-22107635 CACTTGCCTGTCACTGCCTGTGG - Exonic
1037955610 8:23055697-23055719 CCCTTGTTTGTGGAGGCCTGGGG - Intronic
1039917314 8:41869698-41869720 CCTGTGCCTGCCGAGGCCTGGGG + Intronic
1040734614 8:50490694-50490716 CCATTGCCTGCCTACCCCTGGGG - Intronic
1043502276 8:80869978-80870000 CCCTTGCATCTGTAGGACTGAGG - Intronic
1043505616 8:80898948-80898970 CCCTTGCTGGTCTGGTCCTGGGG - Intergenic
1047921885 8:129643790-129643812 CACTTGCCCTTCTAGGCCAGTGG + Intergenic
1048634362 8:136279893-136279915 CTCTTGCCTCTCCAGGCCTGTGG - Intergenic
1050112349 9:2229858-2229880 CCTTTGCCTTGCTAGGCCTCGGG - Intergenic
1051022059 9:12556524-12556546 CCCTTGCCTGGCATGGCCTTAGG + Intergenic
1051049413 9:12913756-12913778 CCCTTGAATGGCTAGTCCTGGGG - Intergenic
1053228299 9:36381518-36381540 CCCTTGTCTGGCTTGGCCTTAGG - Intronic
1056378937 9:86040071-86040093 CAGTTGGCTGTCTAGGGCTGTGG + Intronic
1057097810 9:92327868-92327890 CCCTTGCCTGGCATGGCCTTAGG + Intronic
1057272378 9:93658370-93658392 CCCCTGCCTGGCTTGGCCCGGGG + Intronic
1057382524 9:94581913-94581935 CCCTTGCCTGGCGTGGCCTTAGG - Intronic
1057890357 9:98865224-98865246 CCCTTTGCTCTCTAGGCCTCTGG - Intergenic
1061800893 9:133112946-133112968 CCTGTTCCAGTCTAGGCCTGTGG - Intronic
1062045728 9:134423646-134423668 TCCTTGCCCCTCTGGGCCTGAGG + Intronic
1062089497 9:134667738-134667760 CCCATGACTGTCTGTGCCTGAGG - Intronic
1062363108 9:136196839-136196861 GCCTTGCCTGTCGAGGCAAGAGG - Exonic
1062519046 9:136950086-136950108 CCTTTGCCTGGCTGGGCCGGCGG - Intronic
1062673212 9:137723633-137723655 CCCGTGTCTGTCTGGGCCTGTGG + Intronic
1185482193 X:455169-455191 CCCGGGCCTGTCGAGGGCTGTGG + Intergenic
1186148044 X:6645418-6645440 CCTTTGCCTGGCATGGCCTGAGG + Intergenic
1189974233 X:46446440-46446462 CTGTTTCCTGTCTGGGCCTGGGG - Intergenic
1190410252 X:50130065-50130087 CCCTTGCCTGGCATGGCCTTAGG + Intergenic
1190456089 X:50629036-50629058 CCATGCCCTGTCTAGCCCTGTGG + Intronic
1190914287 X:54798764-54798786 CCCCAGCCTGTCTTGGCCTCTGG - Intergenic
1194993424 X:100569289-100569311 CTCTTGCCTCTCTAGGCAGGGGG - Intergenic
1195240576 X:102947769-102947791 CCCTTGCCTGGCATGGCCTTAGG + Intergenic
1196339492 X:114581453-114581475 CCCCTGCCTAACGAGGCCTGGGG - Intergenic
1196463790 X:115953044-115953066 CCCTTCCCTGTTTTTGCCTGGGG - Intergenic
1196911848 X:120491861-120491883 CCCTTGCCTGGCATGGCCTTAGG - Intergenic
1199461769 X:148093473-148093495 CCCTTACCTGACCAGCCCTGTGG + Intergenic
1199742736 X:150751015-150751037 CCCCTTCCTTTCTAGGCATGGGG + Intronic
1200216056 X:154368734-154368756 CCCTCCCCTGGCTAGGCCTGTGG - Intronic