ID: 1183282412

View in Genome Browser
Species Human (GRCh38)
Location 22:36938649-36938671
Sequence AGTGATTTGCTGAAGGTCAA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 275}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183282412 Original CRISPR AGTGATTTGCTGAAGGTCAA GGG (reversed) Exonic
900850775 1:5141216-5141238 GGTGACTCGCTGAAGGTCACAGG + Intergenic
900885900 1:5415213-5415235 TGTGACTTGCTCAAGGTCACAGG - Intergenic
901833957 1:11911659-11911681 AGTGACTTGCTAAAGGTCAAAGG - Intergenic
903165880 1:21520043-21520065 AGTGACTTGTCCAAGGTCAATGG - Intronic
903315151 1:22497782-22497804 AGTAACTTGCTTAAGGTCACAGG - Intronic
903339051 1:22642915-22642937 AGTGATTTGCTGAAGGCATCTGG + Intergenic
903569378 1:24293207-24293229 AGTAATCTGCTCAAGGTCACAGG - Intergenic
903703897 1:25270718-25270740 AGTGACTTGCTCAAGGTCACAGG - Intronic
903723344 1:25422606-25422628 AGTGACTTGCTCAAGGTCACAGG + Intronic
903796209 1:25930764-25930786 AGTGACCTGCTCAAGGTCACAGG + Intergenic
904371127 1:30048013-30048035 AGTTCTCTGCTGAAGGTCACCGG - Intergenic
904405922 1:30287855-30287877 AGTGATTTGTCCAAGGTCACAGG + Intergenic
904551144 1:31319420-31319442 AGTGATTTGCCTAGGGTCACAGG - Intronic
905240429 1:36577446-36577468 AATGAGTTGGTGAAGGTCACCGG - Intergenic
905850155 1:41267996-41268018 AGTGACTTGCTTAAGGTCACTGG - Intergenic
906025067 1:42666393-42666415 AATGACTTGCTCAAGGTCATAGG - Intronic
906079299 1:43073573-43073595 TGTCACTTGCTCAAGGTCAAAGG + Intergenic
906123254 1:43409324-43409346 AGTTATCTGCTGAGGGTAAAGGG + Intronic
907583174 1:55590389-55590411 AGTCATTTGCAGGAGGACAAAGG - Intergenic
908349404 1:63269870-63269892 GGTGATTTGCTAAAGGTTTATGG - Intergenic
908906644 1:69020255-69020277 AGTGATGGGCTGAACCTCAAGGG + Intergenic
909058691 1:70853392-70853414 AGTGAATGGCTGAAGGAAAAGGG + Intronic
911064171 1:93772940-93772962 AAAGATTTGCTGAAGGGCCATGG + Intronic
912338955 1:108891415-108891437 AATGACTTGCTTAAGGTCATGGG - Intronic
912744804 1:112237183-112237205 AGTGATATGCAGAAGGTCATTGG + Intergenic
916680929 1:167104420-167104442 AGAAATTCACTGAAGGTCAAGGG - Intronic
918774492 1:188610745-188610767 AGTCATTTGCTGAAGATGGAAGG - Intergenic
919980810 1:202642158-202642180 AGTGAGTTGCCCAAGGTCATAGG + Intronic
920211630 1:204332719-204332741 AGTCCCTCGCTGAAGGTCAAGGG + Intronic
920956612 1:210625527-210625549 AGTGAGTTACTGGAGGTCACAGG + Intronic
921013396 1:211164227-211164249 AGTTATTTGAAGAATGTCAATGG + Intergenic
923746031 1:236700967-236700989 AGTGACTTGCCCAAGGTCACCGG - Intronic
1067671323 10:48324819-48324841 ACTGATCTGCTGATTGTCAAGGG - Intronic
1068456993 10:57268729-57268751 GGTAATATGCTGGAGGTCAAAGG - Intergenic
1068581166 10:58741267-58741289 ATTGATTTGCAGAAGGAGAAGGG + Intronic
1068605975 10:59005467-59005489 AGTGATTTGCCCAAGGTTACAGG + Intergenic
1070425267 10:76281150-76281172 AGTGTCTTGCTGAAGAGCAAAGG + Intronic
1070792241 10:79196397-79196419 AGTGTTTTGTTCAAGGCCAAGGG - Intronic
1071990321 10:91094991-91095013 AGTGTTTTGATAAAGGTCATAGG + Intergenic
1072735802 10:97878832-97878854 AGTGACTTCCTGCAGGTAAAAGG + Intronic
1073667204 10:105546871-105546893 AAGGATTAGCTGAAGGTGAATGG - Intergenic
1074062131 10:109976227-109976249 AATGATTTGCTGAATGACATTGG + Intergenic
1075347768 10:121696881-121696903 AGTGACTTGCCAAAGGTCACTGG + Intergenic
1075410872 10:122227047-122227069 AGGGATTTGATGAAGATTAAAGG + Intronic
1075791205 10:125085627-125085649 AGTGATTTGCTGAAGGCTTTGGG - Intronic
1076575054 10:131460172-131460194 AGTGCTTTGTTGAAGAACAATGG + Intergenic
1078136096 11:8652910-8652932 AGTGTTTTGCCCAAGGTCATTGG - Intronic
1079786585 11:24680808-24680830 ATTAACTTGCTCAAGGTCAACGG + Intronic
1080328723 11:31110158-31110180 AGTTGTTTGCAGAAGATCAATGG - Intronic
1080368299 11:31605220-31605242 GGTGATTTGCCCAAGGTTAAGGG - Intronic
1080561003 11:33462672-33462694 AGAAATTTGCTGAAAGTCACTGG - Intergenic
1080931333 11:36814513-36814535 AGTTATTTGCCTAAGGTCAAAGG + Intergenic
1082227171 11:49721802-49721824 AGTGAATTAATGTAGGTCAAGGG + Intergenic
1083870689 11:65486523-65486545 AGTGACTTGCTGGAGGTAACAGG + Intergenic
1085487108 11:76874218-76874240 AGTGATTTGCCCAAAGTCACAGG - Intronic
1086031245 11:82358921-82358943 AGTGATTTGATGAAAATAAATGG + Intergenic
1086533281 11:87812152-87812174 AGTTATTTGCCCAAGGTCAATGG - Intergenic
1086583221 11:88423265-88423287 AGTGACTTGCTCAAGGACATGGG + Intergenic
1086911654 11:92479352-92479374 AGTGACTTGCCTAAGGTCATGGG + Intronic
1087011742 11:93520834-93520856 CGTGACATGCTGAAGGTGAAAGG - Intronic
1087131638 11:94673859-94673881 AGTGAGCTGCAGATGGTCAATGG - Intergenic
1088259111 11:107928286-107928308 AGTGATTTGCAGCCGGTCAGGGG + Intronic
1089091835 11:115884848-115884870 AGTGCTTTGCCTAAGGTCACAGG + Intergenic
1089159286 11:116425062-116425084 AGTGAATTGCCCAAGGTCACAGG + Intergenic
1089270610 11:117299377-117299399 AGTGATCTGCTCAAGGTGACAGG - Intronic
1089586974 11:119515996-119516018 AGAGATTGTCTGAAGGCCAAAGG + Intergenic
1090704065 11:129320760-129320782 AGTGACTTGCTGGAGGTCGTAGG - Intergenic
1092913885 12:13172205-13172227 GGGCAATTGCTGAAGGTCAAAGG + Intergenic
1095578989 12:43773789-43773811 AGTGATTTGCTCAAGGCCCATGG - Intronic
1095917536 12:47495346-47495368 AATGACTTGCTTAAGGTCACAGG - Intergenic
1098859611 12:75693053-75693075 TGTTATTGGCTCAAGGTCAATGG - Intergenic
1101652730 12:106692283-106692305 AGTGCCTTGCTCAAGGTCACAGG - Intronic
1102211004 12:111127236-111127258 AGTTGTTTGCCGAAGGCCAAGGG - Intronic
1102298790 12:111756682-111756704 GGGGATTTGCTGAGGGCCAAGGG + Exonic
1102638402 12:114344792-114344814 AGTGACTTGCTCAAGGTCATAGG - Intergenic
1102972113 12:117177149-117177171 AGGGATTTACTCAAGGTCACAGG + Intronic
1104707587 12:130958939-130958961 AGCGATTTGCTCAAGGTCACAGG + Intronic
1105839084 13:24238037-24238059 AGTGATGTGCTGTAGGTTAAGGG + Intronic
1106997812 13:35508103-35508125 AGTAATTTGCTTAAGATCACAGG + Intronic
1108642149 13:52393140-52393162 AGTAATTTGTCCAAGGTCAATGG - Intronic
1108733823 13:53261604-53261626 AGTGACTTGCCTAAGGTCATGGG - Intergenic
1109959560 13:69613031-69613053 AGTGGTCACCTGAAGGTCAAGGG + Intergenic
1110444493 13:75563725-75563747 TGTGATGTGATGTAGGTCAAAGG - Intronic
1110463360 13:75772544-75772566 AGTGACCTGCTCAAGGTCATAGG + Intronic
1110678220 13:78276384-78276406 ATGGATTTTCTGAAGGTCAGAGG - Intergenic
1111654643 13:91137006-91137028 CATGATTTGCCAAAGGTCAAAGG - Intergenic
1113065006 13:106364173-106364195 AGTGACTTGCTCAAAGTAAATGG - Intergenic
1113267808 13:108638911-108638933 AGGCATTTACTGAAGATCAATGG + Intronic
1114220146 14:20689135-20689157 AGCCATTTGCTGAAGGCCATCGG + Intronic
1114260240 14:21031333-21031355 AGTGACTTGCCCAAGGTCCATGG + Intronic
1114813868 14:25932514-25932536 AGTGACTTGCCCAAGGTCACAGG + Intergenic
1117286368 14:54289621-54289643 AGGGATTGACTCAAGGTCAAAGG - Intergenic
1119478532 14:74945987-74946009 AATGATTTGTTGAAGGTCAATGG + Intronic
1121216376 14:92251519-92251541 AGTGGTTTGCTGAAAGTCTCTGG + Intergenic
1121783354 14:96636800-96636822 AGTGAGTCGCTGAAAGTGAAGGG + Intergenic
1122261331 14:100524759-100524781 ACGGATTTGCTCAAGGTCACAGG - Intronic
1124116539 15:26848604-26848626 TGTGATTGGCTGAAGCTCAGTGG - Intronic
1124496504 15:30190902-30190924 AGTGAGTTGCCCAAGGTCATAGG + Intergenic
1124747071 15:32347746-32347768 AGTGAGTTGCCCAAGGTCATAGG - Intergenic
1125375685 15:39026216-39026238 AGGGAATTGCTGAAGCTCAATGG - Intergenic
1128171568 15:65517864-65517886 AGCGACTTGCTGAAAGTCACAGG + Intergenic
1128356372 15:66930355-66930377 AGTGATTTCATGAAGGTCACAGG - Intergenic
1128465340 15:67906176-67906198 AGTTATTTGCTGAAGTTCTGGGG + Intergenic
1128860521 15:71067284-71067306 TGGGATTAGCTGAAAGTCAAAGG - Intergenic
1129102004 15:73273743-73273765 ATTGATTTACTGAAGGCAAAAGG + Intronic
1129857609 15:78835801-78835823 AGTTACTTGCTTAAGGTCACAGG - Intronic
1131967038 15:97855192-97855214 AGGTATTTGCTGAAGGCAAAAGG + Intergenic
1134366921 16:13587843-13587865 AGTGACTCACTTAAGGTCAATGG + Intergenic
1135652248 16:24216498-24216520 AGTGATTTCCAGAAGTTCCAGGG + Exonic
1136080934 16:27852291-27852313 AGTGACCAGCTGAAGGTCAGGGG - Intronic
1140480135 16:75257932-75257954 AGTGACTGGCTGAAGGCCCACGG - Intronic
1140528039 16:75640300-75640322 ATTCATCAGCTGAAGGTCAATGG - Exonic
1141398537 16:83726281-83726303 AGTCATGTGCTGCAGGTCACAGG + Intronic
1142264856 16:89058938-89058960 ACTGATGGGCAGAAGGTCAAGGG - Intergenic
1142972748 17:3623788-3623810 AGTGACTTGCCGAGGGTCACGGG - Intronic
1143055841 17:4161181-4161203 AGTTATTTGCTGAATGACTAAGG - Intronic
1143355304 17:6323564-6323586 AGTCACTTGCTGAAGGTCACAGG + Intergenic
1146496776 17:33329699-33329721 AGTGATTTGTTTAAGGTTAAGGG - Intronic
1148133760 17:45278565-45278587 AGTAATTTGCCCAAGGTCACTGG + Intronic
1148250944 17:46079651-46079673 AGTGATTTACTGAATAACAAGGG - Intronic
1148892199 17:50816410-50816432 CGTGGTTTGTTGATGGTCAATGG + Intergenic
1149183597 17:53971012-53971034 AGGGATTGCCTGAATGTCAATGG - Intergenic
1150955296 17:69852184-69852206 AGTGATTTGCTATACATCAAAGG - Intergenic
1151383949 17:73743888-73743910 AATACTTTTCTGAAGGTCAAAGG + Intergenic
1151661840 17:75523275-75523297 AGAGATATGCTGAAGGACCACGG - Exonic
1153546839 18:6216072-6216094 AGTGAGTTGGCCAAGGTCAAAGG + Intronic
1154038882 18:10834281-10834303 AGTGATTTGCTCCAAGTCACAGG - Intronic
1156118696 18:33817636-33817658 AGGTACTTGCTGAAGGTAAAGGG + Intergenic
1156197208 18:34788500-34788522 AGTGACTTGCCCAAGGTCATAGG + Intronic
1156749339 18:40431601-40431623 ATTAATTTGCAGAAGGGCAAAGG - Intergenic
1156913318 18:42437012-42437034 AGTGATTTGTCCAAGGTCAGAGG - Intergenic
1157207833 18:45715500-45715522 AGTGACTTGATGAAGTTTAATGG + Intergenic
1157298219 18:46461184-46461206 AGGGACTTGCTCAAGGTCATTGG - Exonic
1159059599 18:63500768-63500790 AGTGATTTGCTGACTTTCCAGGG + Intronic
1162000660 19:7742974-7742996 AGAGATTTTGTGAAGGTCGAAGG + Exonic
1163517376 19:17773319-17773341 AGTGATTTCATGCAGGTAAAGGG + Intronic
1163979532 19:20885987-20886009 AGTGAGTGGCTGAAAGTGAACGG - Intergenic
925143306 2:1564676-1564698 AGTGTTTTGCTGAGATTCAATGG - Intergenic
926584679 2:14673188-14673210 AGTGATTTGCTCAGGGTAAGAGG + Intergenic
927424469 2:22966529-22966551 AATCATTAGCTGAAGGTTAAAGG - Intergenic
927703670 2:25283911-25283933 TGTGATTTGCTCCAGGTCACAGG + Intronic
928803262 2:35119945-35119967 AGTAATATGCTGAATATCAATGG - Intergenic
928986495 2:37187124-37187146 AGGGACTTGCCCAAGGTCAAGGG - Intronic
929174676 2:38964312-38964334 AGTGAGTTGATGAACTTCAATGG - Intronic
929675254 2:43920359-43920381 AGTGAATTGCTTGAGGTCAGGGG - Intronic
929907534 2:46059285-46059307 AGTGATTTTTGGAGGGTCAAGGG - Intronic
930294934 2:49543446-49543468 AGCTATTTGCTGAAGGCAAAGGG - Intergenic
930329310 2:49962536-49962558 AGTGATTTGCCCCAGGTCAATGG - Intronic
931905128 2:66834261-66834283 AGTAATGTGCTCAAGGTTAAGGG - Intergenic
932460894 2:71881214-71881236 TGTGAGTTGCTCAAGGTCACGGG - Intergenic
935354469 2:102186365-102186387 TGTGATAGGCTGAAGGTCAGTGG - Intergenic
936497891 2:113038437-113038459 AGAGATTTGCTGAAAGCAAATGG - Intronic
938963453 2:136363489-136363511 ATTGATTTGCAGCAGGTCATTGG - Intergenic
941981153 2:171458701-171458723 AGTGAATTGCTAAAGGTCTGTGG - Intronic
942205178 2:173612885-173612907 GGTGATTTAGTGAAGGTCCAAGG - Intergenic
942685666 2:178528969-178528991 AGTGATTTCCTCATGGACAATGG + Exonic
944163786 2:196695122-196695144 AGTGACTTGCTGAAGTTCTAGGG - Exonic
945777953 2:214130957-214130979 AGTGGATTTCTGAAGGTGAAGGG - Intronic
946981115 2:225216673-225216695 AGTGACTTTCTCAAGGTCATAGG + Intergenic
948147353 2:235717515-235717537 AGTGATTTGATGATGCTTAACGG + Intronic
948747135 2:240105279-240105301 AGTGACTTGCCCAAGGTCACGGG + Intergenic
1168919585 20:1520206-1520228 AGTGACTTGCCCAAGGTCACAGG - Intergenic
1170267329 20:14481749-14481771 AGTTATTTGCCCAAGGTCATGGG - Intronic
1170286700 20:14717816-14717838 AGTCACTTCCAGAAGGTCAAAGG - Intronic
1171983612 20:31644377-31644399 AGTGACTTGTTGAAGGTCGCAGG + Intronic
1172974394 20:38895389-38895411 AGTGGCTTGCTCAAGGTCAAGGG + Intronic
1175229497 20:57464775-57464797 AGTGACACGCTCAAGGTCAATGG - Intergenic
1175229507 20:57464865-57464887 AGTGACGTGCTCAAGGTCAATGG - Intergenic
1177384783 21:20394489-20394511 GGTGATTTTCTGAAGGAGAATGG + Intergenic
1177604469 21:23360113-23360135 AGAGATTTGCTGCAGGTACAGGG - Intergenic
1178835245 21:36091863-36091885 GGAGAATTGCTGCAGGTCAAAGG - Intergenic
1179375125 21:40843194-40843216 AGTGAATGGATGAAGCTCAAAGG + Intronic
1179633324 21:42691985-42692007 AGTGATGTGCTGATGGTGACAGG - Intronic
1180226135 21:46393580-46393602 AGTGACTGGCTGAAGTCCAAGGG - Intronic
1181568551 22:23753832-23753854 AGTGATTTGCCCCAGGTCAAGGG + Intronic
1183282412 22:36938649-36938671 AGTGATTTGCTGAAGGTCAAGGG - Exonic
950330713 3:12153944-12153966 AGTGAAGTGCTCAAGGTCAGTGG - Intronic
950897907 3:16469973-16469995 AGTGACTTGCTCAAGGTCATGGG + Intronic
953552805 3:43917515-43917537 AGACATTGGCTGAAGATCAATGG + Intergenic
955898311 3:63724740-63724762 AGTGATTGGCCCAAGGTCACAGG + Intergenic
956360337 3:68440586-68440608 AGGCATTTGCTGAAGGCAAAGGG - Intronic
957319243 3:78607699-78607721 AGTGATTTTCTGAGGAGCAAAGG - Intronic
958083572 3:88778131-88778153 ACTGATATGCTGAAGTTCAAAGG + Intergenic
961119261 3:124359583-124359605 AGTGATTTTCACAAGGTCCAGGG - Intronic
964650164 3:159002744-159002766 AGTGACTTGCCCAAGGTCATTGG + Intronic
965071268 3:163917613-163917635 AGTCAGTTGCTGAAGGCAAAGGG + Intergenic
966025451 3:175274657-175274679 AGTAATTTTCTTAAGGTCATAGG - Intronic
967615185 3:191556497-191556519 AGGTATTTGCTGAGGGTAAAGGG + Intergenic
967977914 3:195045709-195045731 AGTGATTGGCTTCAGGTTAAAGG + Intergenic
970542146 4:17090874-17090896 AGGTATTTGCAGAAGGTCCATGG - Intergenic
970967536 4:21946153-21946175 AATGGTTTGCTGAAAGGCAAAGG - Intronic
971072886 4:23114385-23114407 AGAGATTTGCTCCAGGTTAATGG + Intergenic
971355569 4:25891868-25891890 AGAGAATTGCTGAAAGTCAGAGG - Intronic
972614035 4:40681127-40681149 AGTAACTTGCTCAAGGTCAATGG + Intergenic
972845687 4:42986416-42986438 AGAGAGGTGCTGAAAGTCAAAGG - Intronic
974660022 4:64875226-64875248 GTTGATTTGCTGCAGGCCAAAGG - Intergenic
975573147 4:75838051-75838073 GGAGATTTGCCAAAGGTCAAGGG - Intergenic
976602167 4:86948008-86948030 AGTAATTTGCCTAAGGTCACAGG - Intronic
976720279 4:88162790-88162812 ACTGATTTGCACAAGGTTAAAGG + Intronic
977290204 4:95157811-95157833 AGTGCTTTCCAGGAGGTCAAAGG - Exonic
977767825 4:100821405-100821427 AGTGATGTGCTGAAGGAGCAAGG - Intronic
978007499 4:103635535-103635557 GGTGACTTGCTTAACGTCAATGG + Intronic
978171614 4:105677864-105677886 GGTGGTTAGCTGAAGCTCAAGGG + Exonic
978984213 4:114989145-114989167 AGTGATTTTCTGTAGATGAAGGG + Intronic
980385536 4:132085108-132085130 AGATGTTTGCTGAAGGTAAAGGG - Intergenic
980712215 4:136584712-136584734 AGTGATTTGCTGAAAGAAATTGG - Intergenic
981633551 4:146849301-146849323 AGTGAATTGGTGAAGGAGAAAGG + Intronic
981955072 4:150461571-150461593 AGGGATTTTGTGAAGGTTAAAGG + Intronic
982295726 4:153826836-153826858 AATTATTTGAAGAAGGTCAATGG - Intergenic
982749593 4:159144093-159144115 AGTGATTTGCTCCAGGTTAAAGG - Intronic
983780539 4:171665363-171665385 AGAGATAAGCTGAGGGTCAAAGG + Intergenic
984157849 4:176212899-176212921 AATGATTTGCTTAAGGTCATGGG + Intergenic
984635583 4:182106104-182106126 ATTGATTTGCTGGGGGTCAGGGG - Intergenic
985080702 4:186261327-186261349 AATGATTAGCTCAAGGTCACTGG + Intergenic
986406176 5:7427133-7427155 TGTGATTTGCTGACAGTCACTGG + Intronic
989213863 5:38883738-38883760 AGTTATCTGCTGAAGGCAAATGG + Intronic
990171895 5:53060700-53060722 AGGGAAGTGCTGCAGGTCAAAGG + Intronic
990648489 5:57870895-57870917 GGAGATGTGATGAAGGTCAATGG - Intergenic
991273713 5:64818135-64818157 AGTACTTTTCTTAAGGTCAAAGG + Intronic
991995332 5:72380798-72380820 AGTGACTCGCTGAGGGTCACAGG - Intergenic
992203576 5:74407674-74407696 AAAGATTTACTGATGGTCAAAGG - Intergenic
994662206 5:102667592-102667614 AAGGATTTGCCCAAGGTCAAAGG + Intergenic
995219174 5:109628598-109628620 AGAGTTTTGCTCAAGGTCAAAGG - Intergenic
995542393 5:113197776-113197798 AGTAATCTGCTCAAGGTCACAGG + Intronic
995824248 5:116275981-116276003 AGTGTGTTCCTTAAGGTCAAGGG - Intronic
997304480 5:132827653-132827675 AAATATTTGCTGAATGTCAAGGG + Intronic
998150917 5:139757034-139757056 AGTGACCTGCTCAAGGTCCAGGG + Intergenic
998393189 5:141800972-141800994 AGTGACTTTCTCAAGGCCAAGGG + Intergenic
998414912 5:141939056-141939078 AGTTATTTGCTCAAAGACAAAGG - Exonic
998862941 5:146462818-146462840 TGTGATTTCATGAAGGTAAATGG - Intronic
1000815231 5:165912908-165912930 AGGAACTTGCTCAAGGTCAAAGG - Intergenic
1001716906 5:173823908-173823930 AGTCATTTGCCCAAGGTCATAGG - Intergenic
1002013035 5:176299412-176299434 AAAGATTTGCTGAAAGTGAAAGG + Intronic
1004596083 6:17101246-17101268 AGTGACTTTCCCAAGGTCAACGG - Intergenic
1005246052 6:23886435-23886457 GGTGATTTGCCCAAGGTCATAGG + Intergenic
1005611652 6:27531583-27531605 AGTCCTTTACTGGAGGTCAAAGG + Intergenic
1006526346 6:34608872-34608894 AGTGAGGTGCTGAACATCAAAGG - Intronic
1008040590 6:46794472-46794494 AGTGACTTGCTCAAGATCATAGG + Intronic
1008136236 6:47780401-47780423 AATGATTTGCTCAAGATCAGAGG + Intergenic
1008259226 6:49344244-49344266 ACTGATTAGCTGAAAGTCAAGGG + Intergenic
1010536205 6:77034340-77034362 AGTGAATTCCTGCAGGTCAACGG + Intergenic
1010726059 6:79335092-79335114 AGTGATTTGCTGGTTCTCAAAGG + Intergenic
1011553686 6:88552347-88552369 AGTGATTTTCTTAAGGTCCCAGG - Intergenic
1011784799 6:90831588-90831610 AGGGACTTGCCCAAGGTCAATGG - Intergenic
1012329321 6:97964573-97964595 AGTGATGTGCTGAAGCTTACAGG + Intergenic
1012601791 6:101107633-101107655 AGTGATTTGCTTAGAGTCAAAGG + Intergenic
1012894152 6:104929735-104929757 AATGATTTGCTAAAGGTCACTGG + Intergenic
1014533925 6:122594659-122594681 AGATACTTGCTGAAGGTAAAGGG - Intronic
1014946615 6:127506065-127506087 AGTTATTTGCTCAAGGTCATAGG + Intronic
1015028223 6:128562988-128563010 AGTAATTTGCTGAATATTAAAGG - Intergenic
1016551877 6:145290160-145290182 ATTGAATTGCTGAAGTACAATGG - Intergenic
1018792500 6:167159620-167159642 GGTAATTTGCTCAAGGTCACAGG + Intronic
1019049264 6:169170510-169170532 AGTGACTTGCTGGAGGGCGAGGG - Intergenic
1020362745 7:7347274-7347296 ATTGATTTGCTTAATGACAAAGG - Intergenic
1020403238 7:7801869-7801891 AGTGGTCTGCTGAAAGTCAGTGG + Intronic
1020962771 7:14826658-14826680 ATTTATTTGCCTAAGGTCAAAGG - Intronic
1021555873 7:21917018-21917040 AGTGTTTTGCTGAGGGTTACTGG - Intronic
1022229575 7:28400994-28401016 AGTCATTTCCTTAAGATCAATGG - Intronic
1022649073 7:32258494-32258516 ACTGATGTGCTGAGGGACAAGGG + Intronic
1024949434 7:54843959-54843981 GGTCAATTGCTCAAGGTCAAAGG - Intergenic
1026203611 7:68236459-68236481 AATGATTTGCTGAAGATATAAGG + Intergenic
1027512347 7:79098233-79098255 AGGACTTTGCTGAAGGTAAATGG + Intronic
1028913813 7:96237066-96237088 AGTGATTGGCTGAAAGGAAAGGG - Intronic
1030706724 7:112700403-112700425 AATAATTTGCTGAACTTCAAAGG + Intergenic
1032811000 7:135417449-135417471 AGTCATTTCATGAAAGTCAAGGG + Intronic
1034691237 7:153015795-153015817 AGTAATTTGCACAAGGTCACCGG - Intergenic
1034724437 7:153322158-153322180 AGTGACTTGCCCAAGGTCAACGG + Intergenic
1035985862 8:4431144-4431166 AATGATTTGCTCAAAGGCAAGGG + Intronic
1036698128 8:10992667-10992689 AGGGAATTGTTCAAGGTCAATGG - Intronic
1038245651 8:25852524-25852546 AGTCATTTGCTGAATATAAATGG - Intronic
1038259812 8:25983018-25983040 AGTGATTTGTAGAAAGTCATTGG - Intronic
1038718990 8:30016399-30016421 AGTGACTTGCCGAAGCTGAAAGG + Intergenic
1038878845 8:31584209-31584231 AGTGTTTTGGTGAAGGGGAATGG + Intergenic
1040391630 8:46955182-46955204 AGTGATTTCCTGAAGAGCCATGG + Intergenic
1042612790 8:70616430-70616452 AGTAATTTGCCCAAGGTCATAGG + Intronic
1042676603 8:71328499-71328521 AGGGCTTAGCTGAAGGTGAAGGG - Intronic
1044826288 8:96200774-96200796 TGTGATTTTCTCAAGGACAAAGG + Intergenic
1045008659 8:97937926-97937948 AGTCATTTGCACAAGGTCATAGG + Intronic
1046886384 8:119371937-119371959 AGTGATATATTGAAGGTCAGTGG + Intergenic
1046916684 8:119684968-119684990 AGTGAATTACTCAAAGTCAATGG - Intergenic
1047313312 8:123710335-123710357 AGTGATTGCCTGGAGGTGAAGGG + Intronic
1047454488 8:124997379-124997401 TGTGACTTGGTGAAGGTCAATGG + Intergenic
1049034907 8:140067657-140067679 AGTGACTTGATCAAGGTCACAGG + Intronic
1050233107 9:3549541-3549563 AGGGAATTGGTGAAGGCCAATGG - Intergenic
1052316880 9:27124528-27124550 AGTGATGTGCCCAAAGTCAAGGG + Intronic
1052337249 9:27332608-27332630 AGCTATTTGCTCAAGGTAAATGG + Intronic
1052518516 9:29513025-29513047 AGGCATTTGCTGAAGGCCAAAGG + Intergenic
1053230385 9:36402716-36402738 AGGGATTTGCTGAAGCTTAGAGG - Intronic
1053438145 9:38091180-38091202 AGTAACTTGCTTAAGGTCAAGGG + Intergenic
1056163999 9:83924455-83924477 TGTGATTTGCTCATGGTCCAGGG + Intergenic
1057103021 9:92381621-92381643 ATTCATTTGCTGATGGTCACTGG + Intronic
1059303913 9:113339302-113339324 TGTGACTTGCTGAAGGTCACAGG + Intronic
1059368548 9:113806530-113806552 AGTAATTTGCCCAAGGTCACAGG + Intergenic
1059461194 9:114431392-114431414 AGGGACTTGCTCAAGGTCACTGG + Intronic
1059674150 9:116521355-116521377 TTTGCTTTGCTGAAGGTCAGTGG - Intronic
1060075721 9:120589091-120589113 AGTGATTTCCTGAGGGGGAAGGG - Intergenic
1060118545 9:120966436-120966458 ACTGATTTCCTGAAGGTCACTGG + Intronic
1060140721 9:121207729-121207751 AGTGATTTGTCTAAGGTCACAGG - Intronic
1060661384 9:125407311-125407333 GCTGATTTGCTGAGGGTCACAGG + Intergenic
1061863853 9:133481853-133481875 AGTGGTTTGCTGATGTTCAGTGG + Intergenic
1186219410 X:7333707-7333729 AGTAATTTGCCCAAGGTCATGGG - Intronic
1187411745 X:19056645-19056667 AAGGATTTTCTGAAGGTTAAGGG - Intronic
1187708027 X:22026578-22026600 AGTGATTTGCGAAAGGTCACAGG - Intergenic
1188407319 X:29827705-29827727 AGTAATTTGTTTTAGGTCAAAGG - Intronic
1191869958 X:65737451-65737473 AGTTATTTGCTGGAGGCCCATGG - Intronic
1192172699 X:68866870-68866892 AGTAACTTGCTGATGGTCACAGG - Intergenic
1196601806 X:117610021-117610043 TGTGATTTGATGAAGGATAAGGG + Intergenic
1196652642 X:118183987-118184009 AGTGAGTTGCAGAAGAGCAAAGG + Intergenic
1196699284 X:118650134-118650156 AGTGACTTGCTTAGGGTCACAGG - Intronic
1197124528 X:122928786-122928808 AGTGATTTGCTCCAGGTAATGGG - Intergenic
1197451115 X:126619950-126619972 ATTGATTTGCAGAAGACCAAAGG - Intergenic
1198010368 X:132546403-132546425 AGTCATTTGCTGAGAGACAATGG + Intergenic
1198790240 X:140337366-140337388 CCTTATTTGCTGAAGGTGAAGGG + Intergenic
1199915200 X:152332104-152332126 AGTTATCTCCTGAATGTCAAAGG + Intronic
1200793516 Y:7319918-7319940 ATTGATTTGGGGAAGGGCAAGGG + Intergenic
1201588984 Y:15592961-15592983 AGTAATTTGCTCAAGGTCATGGG - Intergenic