ID: 1183284320

View in Genome Browser
Species Human (GRCh38)
Location 22:36952841-36952863
Sequence CTCTGCCTGGCGTGGGATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183284320_1183284328 2 Left 1183284320 22:36952841-36952863 CCACCATCCCACGCCAGGCAGAG No data
Right 1183284328 22:36952866-36952888 GACACCGTAGCCCCTACCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183284320 Original CRISPR CTCTGCCTGGCGTGGGATGG TGG (reversed) Intergenic
No off target data available for this crispr