ID: 1183285393

View in Genome Browser
Species Human (GRCh38)
Location 22:36959480-36959502
Sequence TGCCAGGAAGGGGACCTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183285386_1183285393 2 Left 1183285386 22:36959455-36959477 CCTTGATGATTCTTGAATTACTG No data
Right 1183285393 22:36959480-36959502 TGCCAGGAAGGGGACCTGGCTGG No data
1183285385_1183285393 16 Left 1183285385 22:36959441-36959463 CCACTGACATTCTGCCTTGATGA No data
Right 1183285393 22:36959480-36959502 TGCCAGGAAGGGGACCTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183285393 Original CRISPR TGCCAGGAAGGGGACCTGGC TGG Intergenic
No off target data available for this crispr