ID: 1183286870

View in Genome Browser
Species Human (GRCh38)
Location 22:36971926-36971948
Sequence CTGTCAGACGGAGCAGCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183286870 Original CRISPR CTGTCAGACGGAGCAGCTGG GGG (reversed) Intergenic