ID: 1183287035

View in Genome Browser
Species Human (GRCh38)
Location 22:36973288-36973310
Sequence GAGATGCCCAGCCCCTCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183287035_1183287037 1 Left 1183287035 22:36973288-36973310 CCAAGGGAGGGGCTGGGCATCTC No data
Right 1183287037 22:36973312-36973334 CTTGCCCCACACTTGGCTACTGG No data
1183287035_1183287036 -6 Left 1183287035 22:36973288-36973310 CCAAGGGAGGGGCTGGGCATCTC No data
Right 1183287036 22:36973305-36973327 CATCTCACTTGCCCCACACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183287035 Original CRISPR GAGATGCCCAGCCCCTCCCT TGG (reversed) Intergenic
No off target data available for this crispr