ID: 1183287942

View in Genome Browser
Species Human (GRCh38)
Location 22:36979536-36979558
Sequence GAGCCCTGCAGTTCAGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183287942_1183287947 17 Left 1183287942 22:36979536-36979558 CCACCCACTGAACTGCAGGGCTC No data
Right 1183287947 22:36979576-36979598 TCTCCTAACCTCAGCACTAAGGG No data
1183287942_1183287946 16 Left 1183287942 22:36979536-36979558 CCACCCACTGAACTGCAGGGCTC No data
Right 1183287946 22:36979575-36979597 CTCTCCTAACCTCAGCACTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183287942 Original CRISPR GAGCCCTGCAGTTCAGTGGG TGG (reversed) Intergenic
No off target data available for this crispr