ID: 1183288518

View in Genome Browser
Species Human (GRCh38)
Location 22:36983041-36983063
Sequence ATTTATTTGAAGAAGTTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183288513_1183288518 25 Left 1183288513 22:36982993-36983015 CCTGCTTGGACTGTGGACCTCAA No data
Right 1183288518 22:36983041-36983063 ATTTATTTGAAGAAGTTGCCTGG No data
1183288514_1183288518 8 Left 1183288514 22:36983010-36983032 CCTCAAGTCAGCCTGTAATTATC No data
Right 1183288518 22:36983041-36983063 ATTTATTTGAAGAAGTTGCCTGG No data
1183288512_1183288518 26 Left 1183288512 22:36982992-36983014 CCCTGCTTGGACTGTGGACCTCA No data
Right 1183288518 22:36983041-36983063 ATTTATTTGAAGAAGTTGCCTGG No data
1183288517_1183288518 -3 Left 1183288517 22:36983021-36983043 CCTGTAATTATCTCGGGTTAATT No data
Right 1183288518 22:36983041-36983063 ATTTATTTGAAGAAGTTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183288518 Original CRISPR ATTTATTTGAAGAAGTTGCC TGG Intergenic
No off target data available for this crispr