ID: 1183290618

View in Genome Browser
Species Human (GRCh38)
Location 22:36999681-36999703
Sequence AAGCTGACATAGAGGACACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 205}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183290613_1183290618 19 Left 1183290613 22:36999639-36999661 CCACACATCAAGGACAGGGGACT 0: 1
1: 0
2: 0
3: 12
4: 155
Right 1183290618 22:36999681-36999703 AAGCTGACATAGAGGACACATGG 0: 1
1: 0
2: 1
3: 16
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183290618 Original CRISPR AAGCTGACATAGAGGACACA TGG Intronic
903472031 1:23593869-23593891 AGTGTCACATAGAGGACACAGGG + Intronic
903967869 1:27101273-27101295 GATCTGACAGAGAGGACAGACGG + Exonic
906069288 1:43005974-43005996 TAGCTGACATAGAGGAGACTGGG + Intergenic
910255906 1:85247367-85247389 GAGCTGACATAGTGTACCCATGG - Intergenic
911429352 1:97764090-97764112 AAGTTGATAAAGAGGAAACAAGG + Intronic
911433477 1:97824197-97824219 AATTTGATATAGAGGAGACAAGG - Intronic
912438903 1:109683269-109683291 TAGCTGCCATAGTGGCCACAAGG - Intronic
912441425 1:109701714-109701736 TAGCTGCCATAGTGGCCACAAGG - Intronic
913068968 1:115283171-115283193 GAGCTGGAATAGAGGACAAAAGG - Intergenic
914227414 1:145732358-145732380 AAAATGACATACAGGAAACAAGG + Intronic
918306015 1:183246903-183246925 AAGCTTACATATAGGTCATAAGG + Intergenic
918800480 1:188964113-188964135 AAGTTAAGATATAGGACACAGGG - Intergenic
919568565 1:199219025-199219047 CAGCTGACATAGAGCCCAGAGGG - Intergenic
920276772 1:204812036-204812058 AAACTGACAGAGAGGTCATAGGG - Intergenic
921655498 1:217731141-217731163 AAGGTCAAATAGAGTACACAAGG - Intronic
922957388 1:229614805-229614827 AAGCTAACAAAGAGCAAACAGGG + Intronic
1065198490 10:23290051-23290073 TAGCAGGCATAGTGGACACAAGG + Intronic
1067771666 10:49131103-49131125 ATGCTGTCATATTGGACACATGG - Intergenic
1070821238 10:79355926-79355948 AAGCAGACAAGGAGGACACAAGG + Intergenic
1071292989 10:84200873-84200895 AGGCTGACTTAGAGGACGCCAGG - Intronic
1071679984 10:87695237-87695259 AAGCTCACATGGAGGAAAAACGG + Intronic
1072148922 10:92669558-92669580 AAGCTGATGAAGAGGACACTAGG - Intergenic
1073559018 10:104481341-104481363 AAGGTGACAAAGGGGACAGAAGG - Intergenic
1074675374 10:115843064-115843086 AAGTTGTCACAGAGGTCACATGG - Intronic
1074782430 10:116811628-116811650 AGCCTGACAAAGAGGAGACAGGG - Intergenic
1075321396 10:121494211-121494233 AAGGTGCCATGGAGGAAACAGGG - Intronic
1078991104 11:16647486-16647508 AAGATGGCATATAGGAGACAGGG + Intronic
1079014578 11:16857659-16857681 AAGCTAAAATTCAGGACACAAGG + Intronic
1084383470 11:68828211-68828233 AAGCTGACTTGGGAGACACAGGG - Intronic
1086064323 11:82731076-82731098 AATGTGGCAGAGAGGACACATGG - Exonic
1088814549 11:113412324-113412346 AACCTGACCAAGAGGACCCATGG - Intronic
1089013879 11:115151248-115151270 AAGCTGACTTAGAAGACAGCAGG + Intergenic
1090223981 11:125057725-125057747 AAGGTGTCATGGAGGTCACATGG - Intergenic
1090991424 11:131820251-131820273 AAGCAGACATAGAGGCGATAAGG - Intronic
1092523678 12:9296549-9296571 AAGCTGACCTACAGGATCCACGG - Intergenic
1092543619 12:9435350-9435372 AAGCTGACCTACAGGATCCACGG + Intergenic
1094509324 12:31086701-31086723 AAGCTGACCTACAGGATCCATGG - Intronic
1095175556 12:39088289-39088311 AAGGAGACATTGAGGCCACAGGG + Intergenic
1095998353 12:48108289-48108311 AAGCTGAAATATAAGACCCAAGG + Intronic
1097731078 12:63129062-63129084 AAGCTAACTTGCAGGACACATGG - Intergenic
1103346936 12:120257456-120257478 ACGCTGACATAGATGACATGAGG + Intronic
1104225897 12:126832807-126832829 AAGTGGACATAGAGCACACATGG - Intergenic
1105557570 13:21460802-21460824 GAGATGACATAGAGGAGAAACGG - Intergenic
1108560184 13:51635533-51635555 AATCAGACATGGAGGACAAAAGG - Intronic
1108792317 13:53985690-53985712 AAACTGAGAAAGAAGACACATGG + Intergenic
1109610986 13:64764209-64764231 AAGCTAACACAGAGGATGCAAGG + Intergenic
1109889215 13:68585279-68585301 ATGTTGACATATAGGACATATGG - Intergenic
1110527987 13:76561663-76561685 AAGCAGAAATAAAGGTCACAGGG + Intergenic
1111126820 13:83920378-83920400 AACCTAACATAGGGTACACATGG + Intergenic
1112608317 13:100929914-100929936 AAGATGAAATGGAGGACACAGGG + Intergenic
1112879297 13:104086138-104086160 GAGCTGAGAAAGAAGACACATGG - Intergenic
1113163629 13:107411950-107411972 AGGCTAACATGGAGGCCACAAGG + Intronic
1114575437 14:23708484-23708506 AAGCTGACTTCCAGGAAACAAGG + Intergenic
1115879402 14:37898354-37898376 AAGCTGAGAGAGAGGAGACATGG + Intronic
1116297418 14:43130198-43130220 GAGCTAACATTGAGCACACATGG + Intergenic
1117771176 14:59135998-59136020 ACACTGACATTGTGGACACACGG - Intergenic
1119032147 14:71201054-71201076 CAACTGACAGACAGGACACATGG + Intergenic
1119377873 14:74209239-74209261 GAGCTGACCTTGAGGACCCAGGG + Intergenic
1119626655 14:76182882-76182904 AAGCTGTCATAGAAGACAACAGG + Intronic
1122239626 14:100354062-100354084 CAGCTAACACAGAGCACACAGGG - Intronic
1122367976 14:101207224-101207246 AACCAGACAAAGAGAACACAAGG - Intergenic
1123109732 14:105860389-105860411 AAGCTGACCTAGACTAAACAAGG - Intergenic
1126947378 15:53836903-53836925 AAGCAGAAATACAGAACACAAGG - Intergenic
1132002556 15:98194545-98194567 ATGCTTCCATAGAGGAAACAAGG + Intergenic
1133650970 16:7814349-7814371 AAGATGACACATATGACACATGG - Intergenic
1136356257 16:29746248-29746270 AAGCTGAGAAAGAGGACGCCGGG + Intergenic
1137434173 16:48441953-48441975 ATGCTGACATAAAGTCCACACGG + Intronic
1138740693 16:59306008-59306030 AAGCTCACATATGAGACACAAGG - Intergenic
1140317933 16:73917488-73917510 AAACTGACTTAGAGGACTCTGGG - Intergenic
1140875211 16:79144512-79144534 AAGCTGAAATAGAGTAGAAAAGG - Intronic
1140997963 16:80279473-80279495 AAGCAGACTTAGCGAACACAGGG - Intergenic
1141039249 16:80657291-80657313 AAGCAGACAGAAAGGAAACAAGG + Intronic
1143096732 17:4482342-4482364 AATCAGACTCAGAGGACACAGGG - Intronic
1145752026 17:27361892-27361914 ATCCTGACTTAGAGGTCACACGG - Intergenic
1146264418 17:31442550-31442572 AAGCTGCCACAGAGGCCAAATGG + Intronic
1147595032 17:41711640-41711662 CAGCTGACCTAGAAGACACGGGG + Intergenic
1149873656 17:60207039-60207061 AAGCTGAAATTGGAGACACAGGG + Exonic
1151091568 17:71445812-71445834 AAGTAGAAATGGAGGACACACGG + Intergenic
1152492868 17:80649504-80649526 AAGCTGCCAGTGAGGACTCATGG + Intronic
1154301406 18:13195883-13195905 AAGCAGACATGGGAGACACACGG + Intergenic
1155249527 18:23941300-23941322 AAGCTGATGGAGAGGCCACAAGG - Intronic
1155812849 18:30260231-30260253 AAGCTGGCACAGGGGAGACAGGG - Intergenic
1156427322 18:37028110-37028132 GAGCTAACATTGAGAACACATGG - Intronic
1160864627 19:1251253-1251275 AAGGTGGCATAGAGCACACTGGG + Intronic
1162755047 19:12852886-12852908 AACATGACAAAGAGGTCACAGGG - Intronic
1163812691 19:19443812-19443834 AAGCTGAGGTAGAGGCCACTTGG + Intronic
1165670643 19:37675762-37675784 AAGCTGACCTAAGGAACACAAGG + Intronic
1167796405 19:51712566-51712588 GAGCAGACAAAGAGGACATAGGG + Intergenic
1168490054 19:56801856-56801878 AAGAAGACAGAGAGGACAAATGG + Intronic
925395691 2:3532141-3532163 TAGCTGACACGGAAGACACACGG - Exonic
926853589 2:17227878-17227900 AAGCTGACATCGAGATGACATGG - Intergenic
929789025 2:45010402-45010424 CAGCTTCCATAGAGGCCACACGG - Intergenic
930492153 2:52088647-52088669 AAGGTCACATAAAGGACACAGGG + Intergenic
935947338 2:108298155-108298177 TAGCAGACATAGAGGACAGAAGG - Intronic
936557073 2:113505222-113505244 CAGCAGACAAAGAAGACACAAGG - Intergenic
936828314 2:116608656-116608678 AAACTGAGCTAGAGGTCACATGG - Intergenic
938553006 2:132398017-132398039 AAGCAGACACAGATGAGACATGG - Intergenic
939390431 2:141562192-141562214 AAGCTGACCTAGAGAATTCAGGG + Intronic
939542156 2:143507741-143507763 TTCCTGAGATAGAGGACACATGG - Intronic
939744657 2:145953785-145953807 AAACTGACATTGGGGACTCAAGG - Intergenic
939919153 2:148087031-148087053 AAGATGACAGATAGGAGACAGGG + Intronic
940462233 2:153979744-153979766 AAGCTGACAAAGAGTAAAGAAGG + Intronic
940510747 2:154611227-154611249 ATGTTGACTTAGAGGACAGAAGG - Intergenic
941909691 2:170751968-170751990 AAGCTGATGAAGAGGACACTAGG + Intergenic
942555010 2:177163344-177163366 AAAGAGACATAGAGGAGACAAGG + Intergenic
944913158 2:204329747-204329769 AATCTTAAATAGATGACACATGG + Intergenic
947084511 2:226436162-226436184 AATCTTACAGAGAAGACACAAGG - Intergenic
947625474 2:231615601-231615623 AAGCTGATCAAGAGGACACCTGG - Intergenic
948053207 2:234993338-234993360 AAGCCGTCATAAAGGACAGATGG - Intronic
948409138 2:237745622-237745644 AAGCTGAGAAAGAAAACACACGG - Intronic
948851082 2:240706275-240706297 GAGGTGACACAGAGGACACACGG + Intergenic
1169305988 20:4490805-4490827 TTGCTGTGATAGAGGACACAGGG + Intergenic
1171152249 20:22837484-22837506 AAGCTGCCATTGTGGACACCTGG - Intergenic
1172026934 20:31954950-31954972 AAGGAGACATTGAGCACACAGGG + Intergenic
1172334691 20:34105375-34105397 AAGCTGATGAAGAGGACACTAGG - Exonic
1172398059 20:34623878-34623900 AAGGAGTCATAGAGGACTCAAGG - Intronic
1173393473 20:42656095-42656117 AAGCTGACATGCAGCTCACAGGG + Intronic
1174677180 20:52369769-52369791 AAGTTGACATGGTGGACAGAGGG - Intergenic
1175763619 20:61578112-61578134 CAGCTGGCAGAGAGGACATATGG - Intronic
1176267211 20:64216337-64216359 AAACTGGCATAGAAGGCACAGGG - Intronic
1177224931 21:18242247-18242269 AAGGTGTCATAGAAGACACATGG - Intronic
1178060344 21:28846838-28846860 GAGCTAACATTGAGTACACATGG - Intergenic
1178660082 21:34499938-34499960 AAGATGACAGATAGGAGACAGGG - Intergenic
1178974205 21:37208051-37208073 AAACTGAAATAGAGGACTGAAGG - Intergenic
1179127655 21:38605029-38605051 AAGCTGGAAGAGAGGACAGATGG - Intronic
1182249166 22:28985913-28985935 AAGCTGACAAAGATGAAAAATGG - Intronic
1183290618 22:36999681-36999703 AAGCTGACATAGAGGACACATGG + Intronic
949368519 3:3309158-3309180 AAGGTGAACTATAGGACACAAGG + Intergenic
953318160 3:41947787-41947809 AAGGTGAGATAGAGGAATCAAGG - Intronic
954452896 3:50581200-50581222 AAGCTGAGATACTGGGCACAGGG + Exonic
955331098 3:58048084-58048106 AAACTGTCATAAAGGACACTTGG - Intronic
955486538 3:59439705-59439727 CAGCTGACAGCGAGGAAACAAGG + Intergenic
955596219 3:60593498-60593520 AAGCTAAAATAGAGAACCCAGGG - Intronic
957912993 3:86647018-86647040 AAGCTGACAGAGATAATACATGG + Intergenic
962265693 3:133942872-133942894 AACCAGACCCAGAGGACACAAGG - Intronic
963377059 3:144480876-144480898 AAGCTGAGATAGAGAAGACTTGG - Intergenic
963718364 3:148831012-148831034 AAGCTGAGAGGAAGGACACATGG - Intronic
963822084 3:149908697-149908719 AAGCTGATCTATAGGACAGAAGG + Intronic
964562370 3:158011547-158011569 CAGAAGACAAAGAGGACACAAGG + Intergenic
964888169 3:161508576-161508598 ATGAAGACAGAGAGGACACATGG - Intergenic
966504594 3:180685243-180685265 AAGCTGAAATACAGTACCCAAGG - Intronic
966992346 3:185246260-185246282 AAGCTGACAATGAGGACAGTAGG - Intronic
967250615 3:187534277-187534299 AAGCTGACATTTGGGTCACAGGG + Intergenic
968331106 3:197871263-197871285 AGACTGACATATAGGACATAAGG - Intronic
970257147 4:14180280-14180302 AAGATGACATAGATGACACATGG - Intergenic
971213202 4:24639798-24639820 AGGCTGGCATGGAGGACACGGGG + Intergenic
971512226 4:27440955-27440977 CAGGTGACTCAGAGGACACATGG + Intergenic
972673257 4:41234527-41234549 AAGGTGAAACAGAGGACACAAGG + Intergenic
975640557 4:76495870-76495892 ACACAGACATAGATGACACAAGG + Intronic
977181740 4:93883439-93883461 CACCTGAAATAGAGAACACAAGG - Intergenic
980841193 4:138263611-138263633 AAGCTGACTCAGAGAGCACATGG + Intergenic
981013961 4:139954115-139954137 AAGGTGGCAGGGAGGACACATGG - Intronic
981729208 4:147879745-147879767 GAGCTGACAATGAGAACACATGG - Intronic
984375773 4:178926955-178926977 AAGAAGACATAGAGGAACCAGGG - Intergenic
984585056 4:181553939-181553961 GAGCTGGCAGAGAGGACAGAAGG - Intergenic
986066786 5:4241729-4241751 GAGCTGACATAGTGCACGCAGGG - Intergenic
986609974 5:9557344-9557366 AAGCTAACAAGGAGGACACAGGG + Intergenic
987826004 5:23031153-23031175 AAGCGGACAAAGAGAAAACATGG - Intergenic
988877723 5:35466625-35466647 ATGCTGAGATAGAGGAAAAATGG - Intergenic
988889337 5:35598188-35598210 AAGATGGCAGATAGGACACAGGG + Intergenic
991650006 5:68842975-68842997 AAGCTGAGACAGAGAACACAAGG + Intergenic
991914553 5:71592900-71592922 AAACAGAAATAGAGGAGACAGGG - Intronic
992521102 5:77552260-77552282 AAGCTGACATTAAAAACACAGGG + Intronic
993016161 5:82536750-82536772 AATGTGACCTAGAGGCCACATGG - Intergenic
993366175 5:87036226-87036248 AAGGTGACAGATAGGAGACAGGG - Intergenic
993869048 5:93228281-93228303 AAGTTGGCATAGATCACACAGGG - Intergenic
994740068 5:103606709-103606731 AAACTGCCATAGAGGCCATATGG + Intergenic
994742173 5:103633904-103633926 TTGCTGACACAGAGGACAGATGG - Intergenic
994992487 5:107015028-107015050 AAGCTGACATAGTGGAGAGAAGG - Intergenic
996783810 5:127216503-127216525 AAGCTGACTGAGAGGGAACATGG + Intergenic
999597955 5:153226384-153226406 GAGCTAACATTGAGTACACATGG - Intergenic
1003771778 6:9312610-9312632 TATCTGACATAGAGGCCAGAAGG + Intergenic
1003934032 6:10957159-10957181 AAGCTGAAAAAGAGGAAAGAAGG + Intronic
1005084011 6:21985384-21985406 ACGCTGACATACAGGAACCAAGG - Intergenic
1005281893 6:24283407-24283429 CAGCTGCCATAGTGTACACAGGG - Intronic
1005824780 6:29626360-29626382 AGGGTGAAATAGAGTACACAAGG - Intronic
1006479382 6:34279618-34279640 AGGCTGACATGAAGGACTCAAGG + Intergenic
1007132691 6:39491275-39491297 ACGCTCACACAGAGAACACATGG + Intronic
1007878808 6:45139371-45139393 AAGATGGCAGAGAGGAGACAGGG + Intronic
1009976620 6:70677625-70677647 ACACTGACATAGAAGTCACAAGG - Intronic
1013341350 6:109219244-109219266 AACCAAACATAGAGGATACAGGG + Intergenic
1014335288 6:120125952-120125974 AAGCTGCCAAAGAGGAGACGTGG - Intergenic
1014434495 6:121406199-121406221 AAGCTAACACAGAGGAGAGATGG + Intergenic
1016317595 6:142807803-142807825 AAGCTGCCATAAAGAACAGAAGG + Intronic
1018045515 6:159962677-159962699 AGGCTGACGGAGAGGACTCAAGG + Intergenic
1020869742 7:13612848-13612870 ATGGTGACATTGAGAACACATGG + Intergenic
1021725560 7:23544927-23544949 AAGAGGAGATAGAGGACACCAGG - Intergenic
1022804089 7:33804453-33804475 AAGATAACACAGAAGACACATGG - Intergenic
1027761029 7:82278968-82278990 AAGCTGAAAGAGAAGTCACATGG - Intronic
1030520610 7:110593661-110593683 CAACTGGCAAAGAGGACACATGG - Intergenic
1031250737 7:119377389-119377411 GAGATGGCAGAGAGGACACATGG + Intergenic
1033907467 7:146222978-146223000 AAGATGACAGTGAGGACACTTGG + Intronic
1037041270 8:14237974-14237996 AGGCAGGCATAGAGGACACTGGG - Intronic
1037268090 8:17090526-17090548 ACGCTGACATAGAGCACAAAGGG - Exonic
1037406235 8:18545786-18545808 AAGCTGACATGGAGAACTCTGGG - Intronic
1038178433 8:25202934-25202956 AAGGTGACACAGGGGACACTAGG + Intronic
1040861398 8:52002818-52002840 AAGCTGGTCTAGAGGAGACAGGG - Intergenic
1042724795 8:71861809-71861831 AAGCAGAAATAGAGGAGAAAAGG - Intronic
1043571781 8:81611938-81611960 CAGCTGAAATGGAAGACACAAGG + Intergenic
1043977136 8:86596463-86596485 AAACTGACAAAAAGGGCACAAGG + Intronic
1044517501 8:93156358-93156380 AAGCAGACATGGAAGACAGAGGG - Intronic
1044658576 8:94573266-94573288 TAGCTGGCAAAGAGGAGACAAGG + Intergenic
1047016079 8:120724811-120724833 AAGCTGACTTAGAGGGGCCATGG + Intronic
1048265833 8:132984966-132984988 GAGATGACATAGATGACATAGGG - Intronic
1049588986 8:143447018-143447040 GAGCTGACATGAAGGGCACAGGG + Intronic
1050642026 9:7678508-7678530 AGGCTGACAAAGATGAAACAAGG - Intergenic
1051856174 9:21568003-21568025 TAGCTGACAAAGATGACACATGG + Intergenic
1053472612 9:38357721-38357743 CAGCTTACCTAGAGGTCACAAGG + Intergenic
1056478989 9:86981965-86981987 AAGCAGACATTGAGAACACTTGG + Intergenic
1056929689 9:90863741-90863763 AAGCTGGCATAGAGGACTCCAGG - Intronic
1057730574 9:97604950-97604972 GTGCTGACGTAGAGGACTCATGG + Intronic
1060467776 9:123922669-123922691 AAGCTGAAATACAGGATATAAGG - Intronic
1061763953 9:132869728-132869750 CAGGTGGCATTGAGGACACATGG + Intronic
1062570885 9:137184829-137184851 ATGCAGACACAGAGGAGACACGG + Intronic
1186210039 X:7240923-7240945 AAGCAGAGATTGAGGACACTAGG - Intronic
1186412492 X:9356305-9356327 AAGCTGACAGTGAGAACAGATGG + Intergenic
1187382932 X:18821847-18821869 AGGCTGAGAGAGAGGACCCAAGG + Intronic
1193262603 X:79426432-79426454 ATACTGACAGAGTGGACACAAGG - Intergenic
1193556409 X:82959748-82959770 AAGGTGGCAGAGAGGAGACAGGG + Intergenic
1195437449 X:104861732-104861754 AAGATGACTTAAAGTACACAGGG - Intronic
1199149716 X:144416080-144416102 ATTCTGAAACAGAGGACACAAGG + Intergenic
1201583266 Y:15533039-15533061 AAGCAGAGATTGAGGACACTAGG - Intergenic
1202596978 Y:26550547-26550569 GAGCTGACAATGAGAACACATGG + Intergenic