ID: 1183290972

View in Genome Browser
Species Human (GRCh38)
Location 22:37001961-37001983
Sequence CCATGCCAGGGGACGGATGA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 156}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183290972_1183290979 0 Left 1183290972 22:37001961-37001983 CCGTCATCCGTCCCCTGGCATGG 0: 1
1: 0
2: 0
3: 9
4: 156
Right 1183290979 22:37001984-37002006 CTGAGCCCCCTCTCCCGAGGTGG 0: 1
1: 0
2: 2
3: 12
4: 169
1183290972_1183290978 -3 Left 1183290972 22:37001961-37001983 CCGTCATCCGTCCCCTGGCATGG 0: 1
1: 0
2: 0
3: 9
4: 156
Right 1183290978 22:37001981-37002003 TGGCTGAGCCCCCTCTCCCGAGG 0: 1
1: 5
2: 6
3: 26
4: 247
1183290972_1183290987 21 Left 1183290972 22:37001961-37001983 CCGTCATCCGTCCCCTGGCATGG 0: 1
1: 0
2: 0
3: 9
4: 156
Right 1183290987 22:37002005-37002027 GGCCCTGTTCTCTCTCGAGGAGG 0: 1
1: 0
2: 1
3: 9
4: 101
1183290972_1183290986 18 Left 1183290972 22:37001961-37001983 CCGTCATCCGTCCCCTGGCATGG 0: 1
1: 0
2: 0
3: 9
4: 156
Right 1183290986 22:37002002-37002024 GGTGGCCCTGTTCTCTCTCGAGG 0: 1
1: 0
2: 1
3: 13
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183290972 Original CRISPR CCATGCCAGGGGACGGATGA CGG (reversed) Exonic
901642252 1:10698690-10698712 CCCTGGCAGGGGAGGGCTGAGGG + Intronic
901879064 1:12183278-12183300 CCATGCCAGGGCCAGGATGGCGG - Intronic
903280387 1:22246923-22246945 CCCTGCGAGGGTACAGATGAGGG - Intergenic
903809677 1:26028474-26028496 CCCAGCCAGGGGAGGGATAAAGG - Intronic
908237139 1:62157541-62157563 CCAAGCCAGGAGGGGGATGATGG + Intronic
908553122 1:65229788-65229810 CCATGGCTGGGGACGGCTCAAGG - Exonic
910224064 1:84918467-84918489 CCATGGCGTGGGATGGATGAGGG - Intergenic
911282702 1:95951437-95951459 GCATGCAAGGGGAAGGAAGAAGG - Intergenic
916240571 1:162634905-162634927 GAATGCCAGGGAAAGGATGAAGG - Intronic
916750851 1:167721870-167721892 CCTTCCCGGCGGACGGATGATGG + Intronic
922472031 1:225882620-225882642 TCGTGCCGGGGGACGGAAGAGGG - Intergenic
922743839 1:228031971-228031993 CCATACCAGGTGATGGAGGAAGG + Intronic
922874173 1:228927085-228927107 CCATGCCTGGGCACCGATGAAGG - Intergenic
922874191 1:228927163-228927185 CCATGCCTGGGCACCGAGGAAGG - Intergenic
922951508 1:229561613-229561635 CCATGCCAGGGAAGGCAGGAAGG - Intergenic
923647404 1:235837815-235837837 GCATGCAAGGGAACGGGTGATGG + Intronic
1063208341 10:3855821-3855843 CCATGCGAGAGGACGGAGGTAGG + Intergenic
1067160520 10:43821345-43821367 CCATGCCCAGGGACAGATGAGGG - Intergenic
1067419662 10:46134676-46134698 CCGTGCCCCGGGACTGATGAAGG - Intergenic
1067426356 10:46214735-46214757 CCGTGCCCCGGGACTGATGAAGG + Intergenic
1067505014 10:46841273-46841295 CCGTGCCCCGGGACTGATGAAGG - Intergenic
1067739083 10:48881272-48881294 CCGTGTCAAGGGAAGGATGAAGG + Intronic
1069991942 10:72321466-72321488 TCATGCCTGGGGTCGGCTGAGGG - Intergenic
1071423540 10:85525953-85525975 CCAGGCCAGGGGGCTGCTGAAGG + Intergenic
1074535443 10:114325509-114325531 ACATGCCAGAGGAGGGCTGAAGG - Intronic
1077380803 11:2236465-2236487 CCAGGTCAGGGGACGCATGTGGG - Intergenic
1077463020 11:2720402-2720424 CCCTGCCTGGGGACAGCTGAAGG + Intronic
1078169314 11:8916673-8916695 CCAGGCCAGGGGAGGCATGTGGG - Intronic
1080833607 11:35919233-35919255 CTCTGCCAGGGGAAAGATGATGG - Intergenic
1084179425 11:67439002-67439024 GGAGGCCAGGGGAGGGATGAGGG - Intronic
1084773653 11:71360894-71360916 CCAGGCCAGGGGAAAGAGGAAGG + Intergenic
1085184030 11:74560141-74560163 CCATGGGAGTGGATGGATGAAGG - Intronic
1085562646 11:77486571-77486593 CACTGCCAGGGGATGGAAGAGGG - Intergenic
1086261635 11:84947086-84947108 CATTGCCAGGGGATGGGTGAGGG + Intronic
1087066569 11:94033003-94033025 CCATGCCAAGGGAAGAATCAGGG + Intronic
1088826169 11:113496210-113496232 CCATGCCAGTGGAGGGAGAAGGG - Intergenic
1089620080 11:119717208-119717230 CCCTCCCAGGGGTCAGATGATGG - Intronic
1092853047 12:12648070-12648092 CCATTCCAGGGTATGGAGGATGG + Intergenic
1097736900 12:63192544-63192566 CTAAGCCAGGGGACAGATGGAGG + Intergenic
1098425273 12:70357648-70357670 CCATGCCTGGGGAAGGCAGAAGG + Intergenic
1101991965 12:109493388-109493410 CCAGGACAGGGGAGGGATGCTGG - Intronic
1106227001 13:27793267-27793289 CAACGCCAGGAGGCGGATGAGGG + Intronic
1115247029 14:31306188-31306210 CCATGCCAGGCTAGGCATGATGG + Intronic
1122324432 14:100874232-100874254 CCAGGCCAAGGGACGGAGGATGG - Intergenic
1123085974 14:105717796-105717818 CCAGGCCACAGGACGGTTGAGGG - Intergenic
1124027797 15:25982889-25982911 CCATCCCAGGGGACCCATGAGGG + Intergenic
1126188168 15:45850950-45850972 ACATGGCTGGGGACGAATGAGGG - Intergenic
1129169687 15:73800038-73800060 GCAGGCCTGTGGACGGATGAGGG - Intergenic
1141046788 16:80722798-80722820 CCATGCCAGGAGACAGACTACGG + Intronic
1142356028 16:89602484-89602506 CCATGCGCGGAGTCGGATGAGGG + Intergenic
1146286566 17:31578061-31578083 CCATGGGAGGGGATGGTTGAGGG - Intergenic
1148960069 17:51385365-51385387 CCATGTGAGGGGAAGGATGGCGG - Intergenic
1151334861 17:73433942-73433964 CCATGGCAGGGGGAGGATGAGGG - Intronic
1152045262 17:77930890-77930912 CCATGCCAGGCCACAGCTGAGGG - Intergenic
1152181572 17:78825479-78825501 CATTGCCAGGGGAGAGATGAAGG - Intronic
1152591736 17:81216893-81216915 GGATGTCAGGGGAGGGATGAAGG + Intronic
1152656246 17:81520317-81520339 CCATGCCCAGGGAAGGATCATGG + Intronic
1157392420 18:47313936-47313958 CTGTGCCAGGGGCTGGATGATGG - Intergenic
1158347765 18:56532946-56532968 CCATGGCAGGGGAGAGGTGAAGG + Intergenic
1161244168 19:3239963-3239985 CCATTGGAGGGGACAGATGAGGG - Intronic
1163188159 19:15654076-15654098 CCAGGCCAGGGGCTGGAGGAAGG + Intronic
1163216731 19:15884772-15884794 CCAGGCCAGGGGCTGGAGGAAGG - Intronic
1164672869 19:30082857-30082879 CCATGCCAGAGGCCGTATGCTGG + Intergenic
1164754562 19:30680003-30680025 CCAGGCCAGGGGAGGGAGGGAGG + Intronic
1166544048 19:43623533-43623555 ACATGCCAGGCGAAGGAAGAGGG + Intronic
1168509458 19:56962583-56962605 CAACGCCAAGGGAGGGATGAGGG - Intergenic
927216934 2:20672692-20672714 CCAAGCCAGGGAGCCGATGAGGG - Exonic
930878424 2:56245411-56245433 CTCTGCCAGGGGATGGAGGAGGG + Intronic
934614289 2:95761683-95761705 CCATGCCAGAGCACTGAAGATGG - Intergenic
934897782 2:98133455-98133477 CCAAGCCAGGGGTCTAATGAGGG - Intronic
935995180 2:108763565-108763587 CCATGCCGGGTGAAGGATTAAGG + Exonic
936110489 2:109660597-109660619 CCATGCCAGGAGGCAGATGGGGG + Intergenic
936703818 2:115045641-115045663 CCAGACCAGGGGACGGCGGAGGG + Intronic
937556845 2:123168517-123168539 CCATCCCAAGGGAAGGATCAAGG - Intergenic
939643774 2:144671565-144671587 ACATGCCAGGGAACTGAGGAAGG - Intergenic
946665999 2:222050455-222050477 ACCTCGCAGGGGACGGATGAGGG - Intergenic
947989139 2:234473274-234473296 CCATGCCAGGGGAAGCAGCATGG + Intergenic
949042090 2:241854161-241854183 CCCTCCCAGGGGACGAGTGAGGG + Intronic
1169352161 20:4877012-4877034 ACATACCAGGGGACGGGGGAGGG + Intronic
1170485019 20:16807248-16807270 CCAGGCCAGGGGACGGGAGGGGG - Intergenic
1175926470 20:62473962-62473984 CACTGGCAGGGGAGGGATGAAGG + Intronic
1179226235 21:39455714-39455736 CCAGGCCAGAGGAGGGAAGAGGG - Intronic
1179614493 21:42573034-42573056 CCATGCCATGGCAAGGATGTTGG - Intronic
1180065244 21:45409069-45409091 CCATGCCGGGGGTGGGGTGAGGG - Intronic
1180606637 22:17063982-17064004 CCCTGCCAAGGGAAGGATGGGGG + Intergenic
1182304564 22:29358930-29358952 CACTGCCAGGGCTCGGATGAGGG + Exonic
1183290972 22:37001961-37001983 CCATGCCAGGGGACGGATGACGG - Exonic
1183403237 22:37617014-37617036 ACATGGCGGGGGACGGATGGTGG - Intronic
1184155659 22:42665074-42665096 CCATGCCAGGGCCCGGAGCATGG + Intergenic
1184659660 22:45960059-45960081 CCATGCCAGGGGCAGGATGGTGG - Intronic
1185054788 22:48573979-48574001 CTGTGCCAGGTGAGGGATGAAGG + Intronic
950720820 3:14881459-14881481 CCAGCAAAGGGGACGGATGAGGG + Intronic
954415682 3:50392203-50392225 CCATGCCAGGGGAGGGTGCAGGG - Intronic
954646822 3:52136653-52136675 CCAGGCCAAGGGACAGCTGATGG - Intronic
959573289 3:107908563-107908585 CCACTCCAGGGGAGGGATGCTGG - Intergenic
962015024 3:131430886-131430908 CACTGCCAGGGGATGGAGGAGGG - Intergenic
967904906 3:194491551-194491573 GCATGCCAGGTGAGAGATGAGGG - Intronic
967904935 3:194491674-194491696 GCATGCCAGGTGAGAGATGAGGG - Intronic
967904964 3:194491797-194491819 GCATGCCAGGTGAGAGATGAGGG - Intronic
967904970 3:194491821-194491843 ACATGCCAGGTGAGAGATGAGGG - Intronic
967904975 3:194491845-194491867 GCATGCCAGGTGAGAGATGAGGG - Intronic
969601997 4:8182189-8182211 CCCTGCCAGGGAAGGGAAGAGGG - Intronic
971267266 4:25106519-25106541 CCATGCGATGGGAGGGAGGATGG - Intergenic
972152740 4:36114758-36114780 CCATGCCAAGTGACAGATGGTGG + Intronic
977255325 4:94733756-94733778 CCCTGCTGGGGGAGGGATGATGG - Intergenic
981104269 4:140862976-140862998 CCATGCAATGGCATGGATGAAGG + Exonic
981633965 4:146854030-146854052 TTATCCCAGGGGAGGGATGAGGG - Intronic
984612723 4:181858657-181858679 ATATGCCAGGGGATGGAGGAGGG + Intergenic
984675093 4:182538407-182538429 ACATACCTGGGGACGGAGGAAGG + Intronic
988956475 5:36324746-36324768 CACTGCCAGGGGATGGAGGAGGG + Intergenic
989024935 5:37056323-37056345 CCATGGCAGGGGAAGGTAGATGG + Intronic
996968149 5:129330742-129330764 CCCTGCCAGGGGATGGGAGACGG - Intergenic
999144324 5:149382316-149382338 CGATTCCAGGGGTCGGGTGAGGG + Intronic
999858872 5:155623933-155623955 CCATGCCAGGGCTTAGATGATGG - Intergenic
1002092879 5:176815115-176815137 CCATGCCAGGGTGGGGATGGGGG - Intronic
1002661395 5:180792992-180793014 GCAGGCCAGGGGACGGTTCAAGG + Exonic
1004344565 6:14836729-14836751 ACATGGCAGGGGCAGGATGAGGG + Intergenic
1005081029 6:21956770-21956792 CCCTGCCTGGGGATGGATGAGGG - Intergenic
1005649464 6:27873391-27873413 CCGTGCCAGGCGTCGGATGGCGG + Exonic
1006400692 6:33815426-33815448 ACAGGCCAGGGGAGGGAGGATGG + Intergenic
1007207085 6:40161581-40161603 CCATGTCAGGTGAGGGATGTTGG - Intergenic
1009375389 6:62961773-62961795 CACTGCCAGGGGATGGAGGAGGG + Intergenic
1014205620 6:118651960-118651982 CCAAGCCAGGGCGCGGCTGAGGG + Intronic
1014840919 6:126219064-126219086 CGCTGCCAGGGGATGGAGGAGGG + Intergenic
1016054856 6:139567581-139567603 CACTGCCAGGGGATGGAGGAAGG + Intergenic
1017758606 6:157550931-157550953 CCATGGAAGGGGAAGGATGATGG + Intronic
1017768763 6:157628660-157628682 GGATGACAGGGGACGGAGGAGGG - Intronic
1017770390 6:157639725-157639747 CCGTGCCTGGGGAGGGGTGAGGG + Intronic
1018422568 6:163652274-163652296 CCATGCCAGAGGTCAGAAGAAGG + Intergenic
1018975809 6:168564749-168564771 CCATGACAGGAGGCTGATGACGG + Intronic
1019465593 7:1186393-1186415 AAATGCCAGGGGAGGGATGGAGG - Intergenic
1019897338 7:3992470-3992492 TCAGGCCAGGTGGCGGATGAGGG + Intronic
1021927358 7:25546244-25546266 CTATGCCAGGGCAAGGAGGAGGG + Intergenic
1023858083 7:44197928-44197950 CCTTGCAAGGGGACAGAAGACGG - Intronic
1023882534 7:44328399-44328421 CCATGTCAAGGGCCAGATGATGG - Intronic
1026616902 7:71913210-71913232 CCAGGCCAGGGCATGGAAGATGG + Intronic
1029883057 7:103837149-103837171 ATATGCCAGGGGAAGAATGATGG - Intronic
1032262334 7:130347457-130347479 CCAAGCCAGGGGAAGAAGGAAGG - Intronic
1034275029 7:149820279-149820301 CCATGCCATGGGGCTGTTGAGGG - Intergenic
1034564508 7:151902412-151902434 CCATGCTGGAGGACGGAAGACGG - Intergenic
1036696128 8:10976311-10976333 CCATGGCAGGGGAAGGAAGGAGG - Intronic
1037514391 8:19616374-19616396 CCATCCCAAGGTACTGATGAGGG + Intronic
1039018791 8:33182865-33182887 CCACCCCAGGGGAAGGACGAGGG + Intergenic
1040813755 8:51484679-51484701 CCATGCCAGGTGATGGAAGGTGG + Intronic
1041547464 8:59061840-59061862 CCCTGCCAGGAGAGGGAGGAAGG + Intronic
1043167326 8:76920419-76920441 CCATGTCAGGGGAGGCGTGAGGG - Intergenic
1049211914 8:141390869-141390891 CCATGCAATGGGAAGGATGGAGG + Intergenic
1049802896 8:144526495-144526517 GCCTGCCAGGGCAGGGATGAGGG + Exonic
1054831868 9:69634171-69634193 CGTTGCCAGGGGATGGAGGAGGG - Intronic
1058602153 9:106681828-106681850 CAATCTCAGGGGAGGGATGAAGG + Intergenic
1186729578 X:12394681-12394703 CCATGCCAGAGGAAGTAAGAAGG - Intronic
1188979037 X:36709695-36709717 CCATCCTAGGGGAGGGATAAGGG + Intergenic
1190597334 X:52062550-52062572 ACATGCCAGGGCCCAGATGAGGG - Exonic
1190611490 X:52191523-52191545 ACATGCCAGGGCCCAGATGAGGG + Exonic
1193661005 X:84258344-84258366 CCAGGCCAGGGCACTTATGAAGG + Intergenic
1197706292 X:129636961-129636983 CCTTGGCAGGGGCCGGGTGAAGG + Intergenic
1198503260 X:137274889-137274911 TCATGCCAGGGAACAGATCAGGG - Intergenic
1198971101 X:142281300-142281322 CTATGTAAGGGGACAGATGAGGG - Intergenic
1199643426 X:149883660-149883682 CCCTGCCAGGAGAAAGATGAGGG + Intronic
1199846057 X:151694033-151694055 CCTTGCCAGGGGGCGGAAGAGGG - Intergenic
1200136921 X:153879734-153879756 CCATGCCAGGGAACAGGTGGGGG + Intronic
1200370106 X:155715928-155715950 CACTGCCAGGGGATGGAGGAGGG + Intergenic
1202173844 Y:22079560-22079582 CCATGCTAGGGGAAGAATCATGG - Intronic
1202217516 Y:22506822-22506844 CCATGCTAGGGGAAGAATCATGG + Intronic
1202325669 Y:23689237-23689259 CCATGCTAGGGGAAGAATCATGG - Intergenic
1202545102 Y:25980817-25980839 CCATGCTAGGGGAAGAATCATGG + Intergenic