ID: 1183291432

View in Genome Browser
Species Human (GRCh38)
Location 22:37004127-37004149
Sequence TAGGAACCTCTGATCAGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 110}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183291432_1183291444 17 Left 1183291432 22:37004127-37004149 CCGCCCCTGATCAGAGGTTCCTA 0: 1
1: 0
2: 0
3: 5
4: 110
Right 1183291444 22:37004167-37004189 TCTGGCACTGCCCAGACCCACGG 0: 1
1: 0
2: 5
3: 27
4: 302
1183291432_1183291438 -1 Left 1183291432 22:37004127-37004149 CCGCCCCTGATCAGAGGTTCCTA 0: 1
1: 0
2: 0
3: 5
4: 110
Right 1183291438 22:37004149-37004171 AAGCTGCCCCTGGTGCCCTCTGG 0: 1
1: 0
2: 2
3: 29
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183291432 Original CRISPR TAGGAACCTCTGATCAGGGG CGG (reversed) Intronic