ID: 1183292468

View in Genome Browser
Species Human (GRCh38)
Location 22:37011127-37011149
Sequence GCCTTGGCTGCCTACCTCTG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 614
Summary {0: 1, 1: 0, 2: 1, 3: 72, 4: 540}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183292468_1183292474 5 Left 1183292468 22:37011127-37011149 CCGCAGAGGTAGGCAGCCAAGGC 0: 1
1: 0
2: 1
3: 72
4: 540
Right 1183292474 22:37011155-37011177 GGCAGGCGGTGACTCCCTTGCGG 0: 1
1: 0
2: 1
3: 7
4: 122
1183292468_1183292471 -9 Left 1183292468 22:37011127-37011149 CCGCAGAGGTAGGCAGCCAAGGC 0: 1
1: 0
2: 1
3: 72
4: 540
Right 1183292471 22:37011141-37011163 AGCCAAGGCCACGTGGCAGGCGG 0: 1
1: 1
2: 3
3: 32
4: 330
1183292468_1183292478 22 Left 1183292468 22:37011127-37011149 CCGCAGAGGTAGGCAGCCAAGGC 0: 1
1: 0
2: 1
3: 72
4: 540
Right 1183292478 22:37011172-37011194 TTGCGGCACGTGGCAATGAGAGG 0: 1
1: 0
2: 0
3: 2
4: 51
1183292468_1183292475 12 Left 1183292468 22:37011127-37011149 CCGCAGAGGTAGGCAGCCAAGGC 0: 1
1: 0
2: 1
3: 72
4: 540
Right 1183292475 22:37011162-37011184 GGTGACTCCCTTGCGGCACGTGG 0: 1
1: 0
2: 0
3: 3
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183292468 Original CRISPR GCCTTGGCTGCCTACCTCTG CGG (reversed) Exonic
901045968 1:6395915-6395937 GCCTTAGCTGCCTTCCCCCGGGG - Intergenic
901204742 1:7487775-7487797 GCCTGGGATCCCTTCCTCTGGGG - Intronic
901601453 1:10426501-10426523 GCCTTAGCTGCCTTCCTGTGGGG - Intergenic
902032596 1:13433985-13434007 GCCTTAGCTGCCTCCCTGCGGGG - Intergenic
902100409 1:13983304-13983326 GCCTTAGCTGCCTTCCCGTGGGG - Intergenic
903562391 1:24237479-24237501 GACTTGGCTTCCTGCCCCTGGGG - Intergenic
903914624 1:26754635-26754657 GCCTTGGTTTCCTAACTCAGAGG + Intronic
904496187 1:30888173-30888195 GCCTGGGCTTTCTGCCTCTGTGG - Intronic
905410588 1:37765424-37765446 ACCTTGCCTGCCTACTTCTCAGG - Intergenic
907242836 1:53090253-53090275 GCTCTGCCTGCCTGCCTCTGGGG + Intronic
907338460 1:53716115-53716137 GCCTTGCCTCCCCTCCTCTGTGG - Intronic
908262987 1:62353257-62353279 GCCCTGGCTGCCCACCTCCTAGG - Intergenic
908291362 1:62670108-62670130 GCCTTGGCTGCCTTCCCACGGGG + Intronic
910622652 1:89273527-89273549 GCCTTAGCTGCCTCCCGGTGGGG - Intergenic
910785616 1:90994897-90994919 GCCGTGGCTGCATACATCAGGGG + Intronic
911205944 1:95091585-95091607 GCCTTAGCTGCCTTCCTGCGGGG + Intergenic
911259580 1:95669770-95669792 GCCTTAGCTGCCTTCCCGTGGGG - Intergenic
913469016 1:119171724-119171746 GCCTTAGCTGCCTCCCTGCGGGG + Intergenic
913470204 1:119179243-119179265 GCCTTAGCTGCCTCCCCGTGGGG + Intergenic
913987115 1:143575279-143575301 GCCTTAGCTGCCTCCCTGCGGGG + Intergenic
915261245 1:154678256-154678278 GCCTTAGCTGCCTTCCCATGGGG + Intergenic
915447129 1:155980119-155980141 GTCTTGGCTGCCCACCTCAGGGG - Intronic
915508093 1:156369939-156369961 GTCTTGGCTGCCTACACGTGTGG - Intronic
915764472 1:158349131-158349153 GCCTTAGCTGCCTCCCCGTGGGG - Intergenic
915865531 1:159494750-159494772 GCCTTAGCTGCCTTCCCGTGGGG - Intergenic
916115495 1:161481887-161481909 GCCTGTGCTGGCTACCTGTGCGG - Intergenic
916579710 1:166096346-166096368 GCTTGGGCTGCTTACATCTGTGG + Intronic
917406213 1:174711009-174711031 GCTTTAGCTGCCTCCCTGTGGGG - Intronic
917494381 1:175526797-175526819 GACCTGGCTGCCTACCTATTTGG + Intronic
917793270 1:178513424-178513446 GCCTCTGCTGCCTCCCTCTGGGG + Intronic
917904950 1:179579413-179579435 TCTTGGGCTGCCTACCTCTCCGG - Intergenic
918059027 1:181046049-181046071 GCCTTAGCTGCCTTCCTGCGGGG + Intronic
919377181 1:196809029-196809051 GCCTCAGCTGCCTCCCTGTGGGG + Intergenic
919386892 1:196933930-196933952 GCCTCAGCTGCCTCCCTGTGGGG + Intronic
920883132 1:209898942-209898964 GCCTTAGCTGCCTTCCCGTGGGG - Intergenic
921278408 1:213542019-213542041 ACCTTGTTTGCCTCCCTCTGTGG + Intergenic
921801829 1:219410870-219410892 GCCTTGGCTGCCTTCCCACGGGG + Intergenic
922182123 1:223243528-223243550 GCCTTTGCTGCCTGGCCCTGGGG - Intronic
922610481 1:226923490-226923512 CCCTTGGCTTTCTGCCTCTGGGG - Intronic
922703404 1:227775527-227775549 GCCTTGGCCTCCAAACTCTGCGG - Intronic
923193439 1:231642090-231642112 GCCTTGGCTGCCTTCCCGCGGGG - Intronic
923623219 1:235594572-235594594 GCCTTAGCTGCCTCCCTGCGGGG - Intronic
924219215 1:241855721-241855743 GCCTTAGCTGCCTTCCTGCGGGG - Intronic
1062930326 10:1348534-1348556 CCCTCGGCTGCCTCCATCTGAGG + Intronic
1063072384 10:2679830-2679852 GCCCTGGGAGCCTATCTCTGTGG - Intergenic
1063098397 10:2928259-2928281 ACCTGGGATGCCTTCCTCTGAGG - Intergenic
1063148931 10:3319962-3319984 GCCTTGACTGCCTCCCCGTGGGG - Intergenic
1063309293 10:4937568-4937590 GCCTTAGCTGCCTTCCTGCGGGG - Intronic
1064461041 10:15535154-15535176 GCCTTAGCTGCCTCCCCCAGGGG + Intronic
1065743254 10:28815815-28815837 GCCTTAGCTGCCTTCCTGCGGGG - Intergenic
1065752158 10:28896962-28896984 GCCTTAGCTGCCTTCCCGTGGGG - Intergenic
1066186325 10:33013510-33013532 GCCTTGGCTGCCTTCCCGCGGGG + Intergenic
1066190286 10:33049444-33049466 GCCTTGGCTGCCTTCCCGCGGGG + Intergenic
1066296113 10:34055730-34055752 GCCTTAGCTGCCTTCCTGTGGGG + Intergenic
1066567378 10:36734761-36734783 GCCTTGGCTGCCTTCCCACGGGG - Intergenic
1066598221 10:37076183-37076205 GCCTTAGCTGCCTCCCCATGGGG + Intergenic
1066615043 10:37285308-37285330 GCCTCAGCTGCCTCCCTGTGGGG - Intronic
1066705693 10:38175510-38175532 GCCTGGGCTGCCTCACCCTGAGG - Intergenic
1067370544 10:45678312-45678334 GCCTTGGCTGCCCCACCCTGCGG - Intergenic
1067389238 10:45847844-45847866 GCCTTGGCTGCCCCACCCTGTGG + Intronic
1067416834 10:46109114-46109136 GCCTTGGCTGCCCCACCCTGTGG - Intergenic
1067445020 10:46336705-46336727 GCCTTGGCTGCCCCACCCTGTGG - Intergenic
1067502233 10:46815997-46816019 GCCTTGGCTGCCCCACCCTGTGG - Intergenic
1067592353 10:47524023-47524045 GCCTTGGCTGCCCCACCCTGTGG + Intronic
1067639469 10:48032096-48032118 GCCTTGGCTGCCCCACCCTGTGG + Intergenic
1067738740 10:48879612-48879634 GCCTTGGCTGCAGCCATCTGAGG - Intronic
1067874027 10:49988209-49988231 GCCTTGGCTGCCCCACCCTGTGG - Intronic
1069766163 10:70861861-70861883 GCCTTAGCTGCCTTCCCCTGGGG + Intronic
1070136456 10:73698246-73698268 GCCTTGGCTGCCCCACCCTGTGG + Intergenic
1070314367 10:75296111-75296133 GCCCTGGCTGCACATCTCTGAGG + Intergenic
1070782633 10:79146549-79146571 GCCTTGGCTCCCCTCCTGTGTGG + Intronic
1070973404 10:80586094-80586116 GCCTTAGCTGCCTCCCCGTGGGG + Intronic
1071003780 10:80859472-80859494 GCCTTGGCTGCCTTCCCACGGGG + Intergenic
1071332205 10:84571416-84571438 GCCTTAGCTGCCTCCCCGTGGGG + Intergenic
1071406227 10:85335336-85335358 GCTTTGGTTGCCTACGTTTGTGG - Intergenic
1071797055 10:89018759-89018781 GCCTTAGCTGCCTCCCCATGGGG - Intergenic
1071900983 10:90119969-90119991 GCCTTAGCTGCCTTCCCATGGGG - Intergenic
1072278502 10:93845367-93845389 GCCTTAGCTGCCTCCCTCTGGGG + Intergenic
1073049055 10:100656243-100656265 CCCTTGGCTTCCTGCCTCTGCGG + Intergenic
1073216489 10:101839665-101839687 CCCTTCCCTCCCTACCTCTGCGG + Intronic
1074732483 10:116393582-116393604 GCCTTAGCTGCCTTCCTGCGGGG + Intergenic
1075307642 10:121382337-121382359 GCCTTAGCTGCCTTCCCGTGGGG + Intergenic
1077442290 11:2574421-2574443 GCCTTGGCTCCCACCCTGTGTGG - Intronic
1077603252 11:3588901-3588923 GCCTTAGCTGCCTCCCTGTGGGG + Intergenic
1077778196 11:5294583-5294605 GCCTTAGCTGCCTTCCTGCGGGG - Intronic
1077805786 11:5590097-5590119 GCCTTAGCTGCCTTCCTGCGGGG + Intronic
1077877771 11:6321982-6322004 GCATTAGCTGCCCACGTCTGTGG - Intergenic
1078251879 11:9623177-9623199 GCCTTGGCTGCCTTCCCACGGGG - Intergenic
1079190969 11:18276278-18276300 GCCTTAGCTGCCTTCCTGTGGGG - Intergenic
1079726201 11:23883573-23883595 GCCTTAGCTGCCTTCCTGCGGGG - Intergenic
1079730548 11:23934891-23934913 GCCTTAGCTGCCTTCCTGTGGGG - Intergenic
1079731735 11:23942420-23942442 GCCTTAGCTGCCTTCCTGTGGGG - Intergenic
1080107482 11:28525942-28525964 GCCTTAGCTGCCTCCCCTTGGGG - Intergenic
1080503068 11:32888353-32888375 GCCTTAGCTGCCTCCCCCGGGGG - Intergenic
1080557672 11:33431885-33431907 GCCTTAGCTGCCTTCCCGTGGGG - Intergenic
1081125084 11:39312051-39312073 GCCTTGGCTGCCTTCCCACGGGG + Intergenic
1081126917 11:39333211-39333233 GCCTTAGCTGCCTCCCCATGGGG - Intergenic
1081315211 11:41623050-41623072 GCCTTAGCTGCCTCCCCGTGGGG + Intergenic
1081324447 11:41728237-41728259 GCCTTAGCTGCCTCCCTGTGGGG - Intergenic
1081422090 11:42881601-42881623 GCCTTAGCTGCCTTCCCGTGGGG + Intergenic
1081428408 11:42950104-42950126 GCCTTAGCTGCCTTCCTGTGGGG + Intergenic
1082270421 11:50164186-50164208 GCCTTAGCTGCCTCCCGGTGTGG - Intergenic
1083159723 11:60847699-60847721 GCCTTGGCTACATGCCTCTGAGG - Intronic
1084210484 11:67619255-67619277 GCCTTAGCTGCCTTCCTGCGGGG + Intergenic
1084259147 11:67963444-67963466 GCCTTAGCTGCCTCCATGTGGGG + Intergenic
1084813623 11:71631735-71631757 GCCTTAGCTGCCTCTCTGTGGGG - Intergenic
1085154028 11:74276938-74276960 GCCCTGGCTCCCTACCCCAGGGG + Intronic
1085475437 11:76785870-76785892 CCCATTGCTTCCTACCTCTGTGG + Intronic
1085671075 11:78465112-78465134 GCCTTAGCTGCCTTCCCGTGGGG - Intronic
1086120959 11:83304137-83304159 ACCATGTCTGCCTTCCTCTGTGG - Intergenic
1086524892 11:87713532-87713554 GCCCTGTCTCCCTGCCTCTGAGG + Intergenic
1088626686 11:111734842-111734864 GCCCTGCCAGCCTAACTCTGTGG + Intronic
1089018872 11:115190468-115190490 TCATTGACTGCCTACTTCTGTGG - Intronic
1089062098 11:115634035-115634057 GCCTTAGCTGCCTTCCCGTGGGG - Intergenic
1089244712 11:117110594-117110616 GCCTCAGCTGCCTCCCTGTGGGG - Intergenic
1090744438 11:129695097-129695119 GCCTGGGGTTCCTTCCTCTGTGG + Intergenic
1091305920 11:134536032-134536054 GCTTTGCCTGCCTCCCTGTGAGG - Intergenic
1091402233 12:188259-188281 GCCTTAGCTGCCTTCCCGTGGGG - Intergenic
1092220308 12:6708501-6708523 GCCTTAGCTGCCTTCCTGCGGGG + Intergenic
1092366577 12:7881501-7881523 GCCTTAGCTGCCTTCCCATGGGG + Intronic
1092471789 12:8787485-8787507 GCCTTAGCTGCCTTCCCGTGGGG + Intergenic
1093527067 12:20115371-20115393 GCCTTAGCTGCCTTCCCATGGGG - Intergenic
1093583257 12:20807582-20807604 GCCTCAGCTGCCTCCCCCTGGGG - Intergenic
1093887601 12:24480370-24480392 GCTTTGGCTGCCTGCTTGTGGGG - Intergenic
1094108805 12:26839391-26839413 GCCTCAGCTGCCTCCCTGTGGGG + Intergenic
1094718176 12:33034073-33034095 GCCTTAGCTGCCTTCCCGTGGGG - Intergenic
1095642397 12:44500609-44500631 GCCTTAGCTGCCTCCCTGTGGGG + Intergenic
1095776722 12:46018236-46018258 GCCTTAGCTGCCTTCCTGCGGGG + Intergenic
1096358865 12:50966353-50966375 CCTTTGGATACCTACCTCTGTGG + Intronic
1097982024 12:65744534-65744556 GCCTTAGCTGCCTTCCTGCGGGG + Intergenic
1098063381 12:66586411-66586433 TCCTTCACTGCCAACCTCTGAGG + Intronic
1099190186 12:79554147-79554169 GCCTCAGCTGCCTCCCTGTGGGG - Intergenic
1099191408 12:79565170-79565192 GCCTTAGCTGCCTCCCCGTGGGG + Intergenic
1099523917 12:83696428-83696450 GCCTTAGCTGCCTTCCTGCGGGG - Intergenic
1100157696 12:91820183-91820205 GAGTTGGGTGCCTAGCTCTGTGG + Intergenic
1100166603 12:91924049-91924071 GCCTTAGCTGCCTCCCTGCGGGG - Intergenic
1100980331 12:100157951-100157973 ACCTTTGCTGCCTCCCTCTGTGG - Intergenic
1103439209 12:120950483-120950505 GCCTTAGCTGCCTTCCTGCGGGG - Intergenic
1103678701 12:122676781-122676803 GCCTTAGCTGCCTTCCTGCGGGG - Intergenic
1103783374 12:123414255-123414277 GCCTTAGCTGCCTTCCCGTGGGG - Exonic
1103914678 12:124370125-124370147 GCCCTGGCTGCCTGCCTCCAGGG + Intronic
1104196517 12:126544479-126544501 GCCTTGGCTCTCCAGCTCTGAGG - Intergenic
1105697215 13:22900594-22900616 GCCTTAGCTGCCTCCCTGTGGGG - Intergenic
1105722193 13:23127790-23127812 GCCTTAGCTGCCTTCCCGTGGGG + Intergenic
1106000818 13:25721385-25721407 GCTTTGGTTGCCTGACTCTGAGG + Intronic
1106600542 13:31183195-31183217 GCCTTAGCTGCCTTCCGCCGGGG - Intergenic
1106616245 13:31331257-31331279 GCCCTGGCTGCCTACACCAGTGG + Exonic
1106810969 13:33358199-33358221 GCCTTAGCTGCCTTCCCATGGGG + Intergenic
1107652597 13:42559944-42559966 GCCTTAGCTGCCTTCCCTTGGGG + Intergenic
1108074836 13:46669046-46669068 GCCCTGCCTGCCTGCCTGTGTGG + Exonic
1108510219 13:51148853-51148875 GCCCTGGCTGCCCACCTCAAAGG + Intergenic
1108685451 13:52815404-52815426 GCCTTAGCTGCCTCCCTGAGGGG - Intergenic
1108858939 13:54829642-54829664 GCCTTAGCTGCCTTCCCGTGGGG - Intergenic
1109007784 13:56900948-56900970 GCCTTAGCTGCCTCCCCGTGGGG + Intergenic
1109141069 13:58714301-58714323 GCCTTGGCTGCCTTCCCACGGGG + Intergenic
1109177853 13:59177509-59177531 GGCATGGCTGCCTGCATCTGTGG + Intergenic
1109201888 13:59440128-59440150 GCCTTAGCTGTCTCCCTGTGGGG + Intergenic
1109364656 13:61339383-61339405 GCCTTAGCTGCCTCCCAGTGGGG + Intergenic
1109441387 13:62379446-62379468 GCCTTAGCTGCCTTCCTGCGGGG + Intergenic
1109563148 13:64077679-64077701 GCCTTAGCTGCCTTCCCATGGGG - Intergenic
1110862158 13:80355765-80355787 GCCTTAGCTGCCTTCCTGTGGGG + Intergenic
1110874348 13:80490704-80490726 GCCTTAACTGCCTTCCCCTGGGG - Intergenic
1112842707 13:103600158-103600180 GCCTTAGCTGCCTTCCTGCGGGG + Intergenic
1113472352 13:110555934-110555956 GCCTTGGGTGCCTGTCACTGAGG - Intronic
1114560288 14:23585023-23585045 GCCTTAGCTGCCTTCCCATGGGG - Intergenic
1114593556 14:23891975-23891997 GCCTTAGCTGCCTTCCCGTGGGG + Intergenic
1115268614 14:31527230-31527252 ACCTTTGCTGCCTCCCTGTGGGG - Intronic
1116103278 14:40468068-40468090 TCCTTGGCAGCCTATCTGTGAGG - Intergenic
1116390544 14:44384961-44384983 GCCTTAGCTGCCTTCCCGTGAGG + Intergenic
1116558304 14:46342172-46342194 GGCTTCTCTGCCTGCCTCTGAGG + Intergenic
1116656978 14:47665749-47665771 GCCTTAGCTGCCTCCCTGCGGGG + Intronic
1118010105 14:61602060-61602082 GCTTTGGCAGCCTCCCTGTGTGG - Intronic
1118616169 14:67575827-67575849 CCCTGGGCTGCCTGCCTGTGCGG + Exonic
1119259891 14:73231904-73231926 GCCTTGACTGCTGGCCTCTGGGG + Intergenic
1120439091 14:84513051-84513073 GCCTTAGCTGCCTTCCCTTGGGG - Intergenic
1122463664 14:101916442-101916464 GCCTTGGGCTCCTTCCTCTGTGG - Intronic
1122972464 14:105157996-105158018 GCCTGGGCTCCCTACCGTTGGGG + Intronic
1124036377 15:26057091-26057113 GCCTTAGCTGCCTCCCTGTGGGG + Intergenic
1124198571 15:27656589-27656611 GCCTTAGCTGCCTCCCCATGGGG - Intergenic
1124573146 15:30883975-30883997 GCCTTGGCTGCCTTCCCACGGGG + Intergenic
1127766043 15:62186704-62186726 GCCTTAGCTGCCTCCCCCAGGGG - Intergenic
1128598553 15:68975811-68975833 GCCTTAGCTGCCTCCCCGTGGGG - Intronic
1129777479 15:78246279-78246301 GCCTTAGCTGCCTTCCCGTGGGG - Intergenic
1130965073 15:88691086-88691108 GTCTTGGTTGCCTATCACTGGGG - Intergenic
1131012694 15:89031842-89031864 GCCTTAGCTGCCTTCCCGTGGGG - Intergenic
1131282384 15:91032350-91032372 ACCTTTGCTGCCTCCCTCTGTGG - Intergenic
1131507808 15:93032046-93032068 GCCTTAGCTGCCTTCCCGTGGGG + Intergenic
1131846097 15:96491976-96491998 GCCTTAGCTGCCTCCCTGCGGGG - Intergenic
1132155825 15:99494819-99494841 GCCTTAGCTGCCTACCTGCGGGG - Intergenic
1132457977 16:34819-34841 GCTTTGGCTGGCTTCCCCTGGGG - Intergenic
1132568761 16:635069-635091 GCCTTGGCTGACTCCCTCTTGGG - Intronic
1132903438 16:2270598-2270620 GCCTTAGCAGCCTGGCTCTGGGG - Intergenic
1133367513 16:5222147-5222169 GCCTTAGCTGCCTCCCTGCGGGG - Intergenic
1137010648 16:35316772-35316794 ACCTTGGCTGTCTACCTTTTAGG + Intergenic
1137764508 16:50967594-50967616 GCCTTGGCTTCCTGCCTCACTGG - Intergenic
1138889871 16:61128925-61128947 GCCTCCGCCGCCTACCTATGGGG - Intergenic
1139125519 16:64072470-64072492 GCCTTAGCTGCCTTCCCGTGGGG - Intergenic
1139373474 16:66482182-66482204 TGCTTGGCTGCCACCCTCTGTGG - Intronic
1139377674 16:66510492-66510514 GCCTTGACTTCCTAACTCTCTGG + Exonic
1140017571 16:71202884-71202906 GCTATGTCTGCCTACCTCTCTGG - Intronic
1140378559 16:74465447-74465469 GCCTTAGCTGCCTCCCTAGGGGG - Intronic
1140457842 16:75115071-75115093 CCGTGGGCTGCCTGCCTCTGGGG - Intronic
1141965206 16:87437491-87437513 GCCTTGGCTGCCACGCGCTGTGG - Intronic
1142207433 16:88790825-88790847 GCCATCACTGCCTGCCTCTGTGG + Intergenic
1142478483 17:204000-204022 GCCTGGTCTGCGTACCTCAGAGG - Intergenic
1142505687 17:361812-361834 GCCTTGGCTGCCTTCCCACGGGG + Intronic
1142806488 17:2373677-2373699 GCCTCTGCTGCCTACTTCTCTGG + Intronic
1142828797 17:2532278-2532300 GCCTTAGCTGCCTCCCTGCGGGG - Intergenic
1143127974 17:4656694-4656716 GCCTTAGCTGCCTTCCCGTGGGG - Intergenic
1143250577 17:5520453-5520475 GCCTTGGTTGCATACATTTGAGG - Intronic
1143407185 17:6685395-6685417 GCCTTGGCTGGCACCCTCTGGGG - Exonic
1144226629 17:13155593-13155615 TCCTTGGCTACATACCTCTTGGG + Intergenic
1145094856 17:20016646-20016668 GCCTTAGCTGCCTCCCTGCGGGG + Intronic
1146740447 17:35279056-35279078 GCCTTAGCTGCCTTCCCGTGGGG - Intergenic
1148366157 17:47057424-47057446 GCCTTAGCTGCCTTCCCGTGGGG - Intergenic
1148382384 17:47209444-47209466 GGCTTGGCTGCCTCCTTCTTAGG - Exonic
1148875515 17:50684669-50684691 GCCTAAGCTGCCTCCCTCTGAGG + Intronic
1150775835 17:68080831-68080853 GCCTTAGCTGCCTCCCTGCGGGG + Intergenic
1150804590 17:68309051-68309073 GCCTTAGCTGCCTTCCTGTGGGG - Intronic
1151866450 17:76806333-76806355 GCCTTAGCTGCCTCCCTGCGGGG + Intergenic
1151980371 17:77504783-77504805 GGCTGGGCTGCAGACCTCTGGGG + Intergenic
1152377074 17:79924424-79924446 GCCTGGGCTCCCCACCTCTCTGG + Intergenic
1152460858 17:80441670-80441692 GCCTTGGCTCCCTCCCTCTCCGG + Intergenic
1152619032 17:81352189-81352211 GCCTTAGCTGCCTTCCCGTGGGG - Intergenic
1152962697 18:89259-89281 GCCCTGGCTGCCTGGCCCTGTGG - Intergenic
1153048757 18:881616-881638 GCCTTGGATGCCTTCCTCTACGG - Intergenic
1153070397 18:1098446-1098468 GCCTTAGCTGCCTCCCTGTGGGG + Intergenic
1153087265 18:1302623-1302645 GTCTTGCAAGCCTACCTCTGTGG - Intergenic
1154391340 18:13938978-13939000 CCCTTGCCAGCCTACCTGTGTGG - Intergenic
1155208028 18:23577771-23577793 GCCTTGGCTGCCTTCCCACGGGG - Intronic
1155271935 18:24149695-24149717 GCCTTAGCTGCCTTCCTGCGGGG - Intronic
1155295011 18:24376721-24376743 GCCTTAGCTGCCTTCCTGCGGGG - Intronic
1155772893 18:29723736-29723758 GCCTTGGCTGCCTTCCCACGGGG + Intergenic
1156079514 18:33316396-33316418 GCCTTAGCTGCCTCCCCGTGAGG + Intronic
1156610484 18:38718570-38718592 GCCTTAGCTGCCTTCCCGTGGGG - Intergenic
1156735788 18:40257292-40257314 GCCTCTGCTACTTACCTCTGTGG + Intergenic
1157856891 18:51111990-51112012 GCCTTAGCTGCCTCCCTGCGGGG - Intergenic
1158169279 18:54578079-54578101 GCCCTGGATGCCTCCCTCAGAGG + Intergenic
1158569420 18:58584474-58584496 GCCCTGGCTGCCTGGCTCTGTGG + Intronic
1158705734 18:59790593-59790615 GCCTTAGCTGCCTTCCCGTGGGG - Intergenic
1159656085 18:71031479-71031501 GCCTTGGCTGCCTTCCCAAGGGG - Intergenic
1160243005 18:77136466-77136488 GCCTTTCCTGGCTCCCTCTGGGG - Intergenic
1160258270 18:77265734-77265756 GCCTTGGCAGCTTACCCATGAGG - Intronic
1160406464 18:78649697-78649719 GCCCGGGGTGCCAACCTCTGCGG - Intergenic
1161365632 19:3877811-3877833 GCCTGCGCTCCCTGCCTCTGAGG - Intergenic
1162237663 19:9321612-9321634 GCCTTAGCTGCCTTCCCGTGGGG + Intergenic
1162459321 19:10804867-10804889 TCCTTTGCTGACTACCTCGGGGG - Intronic
1164144013 19:22499130-22499152 GCCTTAGCTGCCTTCCTGTGGGG - Intronic
1165036396 19:33036814-33036836 GCCTTAGCTGCCTTCCCGTGGGG + Intronic
1165149259 19:33751345-33751367 CCCTTGGATGTCTACGTCTGAGG - Intronic
1165846602 19:38821715-38821737 GCCTCAGCTGCCTCCCTGTGGGG + Intronic
1166649703 19:44563346-44563368 GCCTTGGCTGCCTTCCCACGGGG - Intergenic
1166794677 19:45419371-45419393 GCCCTGGCTGCCAATCCCTGCGG - Intronic
1167023490 19:46896654-46896676 GCCCCAGCTGCCTGCCTCTGAGG - Intergenic
1167080333 19:47273351-47273373 GCCTTCGGGGCCTGCCTCTGAGG - Intergenic
1168136503 19:54355664-54355686 TCCTTGGATCCCTCCCTCTGGGG + Intronic
925098954 2:1229740-1229762 GCCTTGGCTGCCTTCCGGCGGGG - Intronic
926444523 2:12926694-12926716 GCCTTAGCTGCCTTCCTACGGGG - Intergenic
927357092 2:22186519-22186541 GCCTTAGCTGCCTTCCTGCGGGG + Intergenic
928272265 2:29867034-29867056 GCCCTGGATGCCAACTTCTGGGG + Intronic
928617925 2:33057569-33057591 GCCTTAGCTGCCTCCCTGTGGGG - Intronic
928753212 2:34494512-34494534 GCCTTGGCTGCCTTCCTACGGGG + Intergenic
928880596 2:36092460-36092482 GCCTCAGCTGCCTCCCTGTGGGG + Intergenic
929201874 2:39244494-39244516 GCCTTAGCTGCCTTCCTGCGGGG + Intergenic
929958312 2:46477578-46477600 GGCCTGCCTGCCTGCCTCTGTGG - Intronic
930031119 2:47058679-47058701 GGCTTGGCTGCCCACTCCTGGGG - Intronic
930468204 2:51780453-51780475 GCCTTAGCTGCCTCCCCATGGGG - Intergenic
931239207 2:60437613-60437635 GCCCTGGGTGCCTCTCTCTGAGG - Intergenic
932239952 2:70148524-70148546 GCCTTAGCTGCCTTCCTGCGGGG + Intergenic
932359502 2:71092629-71092651 GCCTTAGCTGCCTTCCCGTGGGG - Intergenic
932467838 2:71934939-71934961 GCCATGTCTGCCTCTCTCTGTGG + Intergenic
935161160 2:100530654-100530676 GACATGGCTGCCTTCCTCTGAGG - Intergenic
935922840 2:108033890-108033912 GCACTGGGTGCCTACTTCTGAGG - Intergenic
936152023 2:110027267-110027289 GCACTGCCTGCCTACCTCAGGGG - Intergenic
936192655 2:110344146-110344168 GCACTGCCTGCCTACCTCAGGGG + Intergenic
936938997 2:117863570-117863592 GCCTTGCCTGCTTCCCTCAGGGG + Intergenic
936976180 2:118224514-118224536 GCCTTTGCCGCCTGGCTCTGCGG + Intergenic
937202540 2:120214018-120214040 GCTCTGGTTGCCTACCTCAGCGG - Intergenic
937203639 2:120222579-120222601 TCCGTGGCTGCCTGCGTCTGGGG - Exonic
937209578 2:120259892-120259914 GCCTTGGCTGCCTTCCCACGGGG - Intronic
937914306 2:127091505-127091527 GCCTTGATTTCCTACTTCTGGGG - Intronic
938097784 2:128474735-128474757 GCCTTGTCTGCCTCCTTCTGTGG - Intergenic
938245990 2:129778468-129778490 GCCTTGTCTGCCCATCTGTGTGG + Intergenic
938368865 2:130756374-130756396 GCCTTGGCGACTTACCGCTGGGG - Exonic
938386891 2:130873009-130873031 GCCTTGGCTGCCTGACTCAGAGG - Intronic
938726010 2:134109487-134109509 GCCTTAGCTGCCTCCCTGGGGGG - Intergenic
939738760 2:145881041-145881063 GCCTTAGCTGCCTTCCTGCGGGG - Intergenic
939777340 2:146403833-146403855 GCCTTAGCTGCCTTCCCATGGGG - Intergenic
939972527 2:148678542-148678564 GCCTTAGCTGCCTTCCCGTGTGG - Intronic
941705852 2:168657580-168657602 GCCTTGGCTGCCTTCCCACGGGG - Intronic
941712106 2:168725039-168725061 GCCTTAGCTGCCTTCCCATGGGG - Intronic
941820812 2:169841752-169841774 GCCTTGGCTGCCTTCCCGCGGGG + Intronic
943941428 2:194002882-194002904 GCCTTAGCTGCCTCCCCGTGGGG - Intergenic
944843131 2:203643014-203643036 GCCTTAGCTGCCTTCCCGTGGGG - Intergenic
945451480 2:210000758-210000780 GCCTTAGCTGCCTCCCTCTACGG - Intergenic
947592595 2:231394110-231394132 GGCCTGGCTGCCTGCCACTGAGG - Intergenic
947840952 2:233207692-233207714 GCCTTTTCTTCCTATCTCTGTGG + Exonic
948449090 2:238057995-238058017 GCCTTAGCTGCCTCCCCGTGGGG - Intronic
948588635 2:239036084-239036106 CCCCTGGCTGCCTCCCCCTGGGG - Intergenic
948944040 2:241210398-241210420 GCCTCTGCTGCCTGCCTCGGGGG + Intronic
1168892980 20:1306526-1306548 GCCATGGCTGCCTCCATTTGAGG - Exonic
1169645338 20:7803702-7803724 GCCTTAGCTGCCTTCCCGTGGGG - Intergenic
1170230862 20:14044968-14044990 GCCTTAGCTGCCTCCCTGTGGGG - Intronic
1170649521 20:18226984-18227006 GCCTTAGCTGCCTCCCTGCGGGG + Intergenic
1170945100 20:20884456-20884478 TCCTTGCCTGACAACCTCTGAGG - Intergenic
1173656013 20:44700810-44700832 GCCTTCAATGCCTTCCTCTGGGG - Intergenic
1173777453 20:45722475-45722497 GCCTTAGCTTCATACCTTTGAGG - Exonic
1173831528 20:46092069-46092091 GCCTTAGCTGCCTCCCCGTGGGG + Intergenic
1174162874 20:48564249-48564271 GCCTTAGCTGCCTCCCTGCGGGG - Intergenic
1174760456 20:53201891-53201913 GCCCTGGCTGACAACCGCTGGGG + Intronic
1175642503 20:60642789-60642811 CCCTTGCCAGCCTCCCTCTGTGG + Intergenic
1176872233 21:14093112-14093134 ACCTTAGCTGCCTCCCTGTGGGG - Intergenic
1176966598 21:15218717-15218739 GCCTTGGCTGCCTTCCCGCGGGG - Intergenic
1177674912 21:24284667-24284689 GACTTCCCTGCCTGCCTCTGAGG - Intergenic
1178327013 21:31654406-31654428 GCCTTAGCTGCCTCCCTGCGGGG + Intergenic
1180027273 21:45174016-45174038 CCCTTGGCTGCCAATCTTTGAGG - Intronic
1180981447 22:19879900-19879922 CCCTTGGCTGCCTTGTTCTGAGG - Intronic
1182003627 22:26941139-26941161 GCCTTGCATGCCCACGTCTGGGG - Intergenic
1182060357 22:27392888-27392910 GCCATGCCTGCCCTCCTCTGGGG - Intergenic
1182308974 22:29391262-29391284 GGCATGGCTGCTTTCCTCTGAGG + Intronic
1182619362 22:31610450-31610472 GCCTTCCCTGCCTGCCTCAGTGG + Intronic
1183238185 22:36636009-36636031 GCTTTTTCTGCATACCTCTGAGG + Intronic
1183292468 22:37011127-37011149 GCCTTGGCTGCCTACCTCTGCGG - Exonic
1183666729 22:39250357-39250379 TCCTTTGCTGCCTGCCTCTTGGG + Intergenic
1184213910 22:43053645-43053667 TCCTTGTCTGCCTCACTCTGAGG + Intronic
1184380199 22:44140593-44140615 GCCCTGGCTGCCTGACTCTAAGG - Intronic
1185085793 22:48740337-48740359 GCATTGGCTGCGTGGCTCTGAGG + Intronic
1185113486 22:48917829-48917851 GCCTTGCCTGCCGAGATCTGAGG + Intergenic
1185376365 22:50484321-50484343 GCCTTGACTGCCTCGCTGTGCGG - Exonic
949770012 3:7568815-7568837 GCCTTAGCTGCCTCCCCGTGGGG + Intronic
950035017 3:9878956-9878978 GACTGGGCTGCCTGCCTGTGAGG - Intronic
950400998 3:12769009-12769031 GCCTTAGCTGCCTCCCTGAGAGG - Intronic
950470177 3:13179931-13179953 GCCTTAGCTGCCTTCCCGTGGGG + Intergenic
950600359 3:14029636-14029658 GCCTTAGCTGCCTTCCCGTGGGG - Intronic
950633973 3:14302355-14302377 GCCCTGTCTGCTCACCTCTGTGG - Intergenic
951332939 3:21387394-21387416 GCCTTAGCTGCCTCCCCGTGGGG - Intergenic
953089847 3:39713534-39713556 GCCTTGGCTGCCTTCCCACGGGG + Intergenic
953307591 3:41844310-41844332 GCCTTAGCTGCCTTCCCATGGGG - Intronic
953916904 3:46926175-46926197 GGCGTGGCTGCCTACAGCTGTGG + Intronic
956481476 3:69677672-69677694 GCCTTAGCTGCCTTCCCTTGGGG + Intergenic
956563643 3:70612031-70612053 GCCTTAGCTGCCTCCCCATGGGG + Intergenic
957009163 3:74985267-74985289 GCCTTAGCTGCCTTCCTGCGGGG - Intergenic
957277484 3:78108607-78108629 GCCTTAGCTGCCTTCCCGTGGGG + Intergenic
957885515 3:86282440-86282462 GCCTTTGCTGCCTCCCAGTGGGG + Intergenic
957995124 3:87679317-87679339 GCCTTGGCTGCCTTCCCACGGGG + Intergenic
958810749 3:98858112-98858134 GCCTTAGCTGCCTCCCCGTGGGG - Intronic
959422759 3:106148846-106148868 GCCTTAGCTGCCTTCCTGTGGGG + Intergenic
959580116 3:107974733-107974755 GCCTTCACTGCATAGCTCTGTGG + Intergenic
960149784 3:114238431-114238453 GCCTTAGCTGCCTTCCCGTGGGG - Intergenic
960761654 3:121078695-121078717 GCCTTAGCTGCCTCCCTGTGGGG - Intronic
960868584 3:122227363-122227385 GCCTTAGCTGCCTCCCCGTGGGG - Intronic
961460482 3:127046896-127046918 GCCTTAGCTGCCTTCCTGCGGGG + Intergenic
961461940 3:127056249-127056271 GCCTTAGCTGCCTCCCTGTGGGG - Intergenic
961874404 3:130010815-130010837 GCCTTAGCTGCCTCCCCGTGGGG + Intergenic
962600483 3:136987729-136987751 GCCTTAGCTGCCTTCCCGTGGGG - Intronic
963509138 3:146225573-146225595 GCCTTAGCTGCCTTCCTGCGGGG - Intronic
963533285 3:146497517-146497539 GCCTTAGCTGCCTCCCCGTGGGG + Intergenic
963742998 3:149098035-149098057 GCCTTAGCTGCCTTCCCGTGGGG - Intergenic
964037560 3:152217521-152217543 GCCTTAGCTGCCTCCCTGTGGGG + Intergenic
964265359 3:154889378-154889400 GCCTCAGCTGCCTCCCTGTGGGG - Intergenic
964375063 3:156041495-156041517 GCCTTAGCTGCCTCCCTGCGGGG + Intronic
964378533 3:156073336-156073358 GCCTTAGCTGCCTCCCCATGGGG + Intronic
964387158 3:156160174-156160196 GCCTTGGTTCCCTAGCTCTTGGG - Intronic
964974193 3:162599917-162599939 GCCTTGGCTGCCTTCCCGCGGGG + Intergenic
964983136 3:162710651-162710673 GCCTTAGCTGCCTCCCTATGGGG - Intergenic
965446480 3:168780315-168780337 GCCTTAGCTGCCTTCCCGTGGGG + Intergenic
966096770 3:176213561-176213583 GCCTTAGCTGCCTTCCCGTGGGG - Intergenic
966222390 3:177563994-177564016 GACTTGCCTGCTTTCCTCTGAGG - Intergenic
966725023 3:183101116-183101138 GCCTTGGCTGCCTTCCCACGGGG + Intronic
966725411 3:183103887-183103909 GCCTTGGCTGCCTCCCCGCGGGG - Intronic
967182619 3:186919578-186919600 TCCTTCCCTCCCTACCTCTGTGG + Intergenic
967234083 3:187367712-187367734 GCCTTAGCTGCCTCTCTGTGGGG - Intergenic
967448524 3:189596343-189596365 GCCTTAGCTGCCTTCCCGTGGGG + Intergenic
967499133 3:190177190-190177212 GCCTTAGCTGCCTTCCCGTGGGG - Intergenic
969531769 4:7734381-7734403 CCCTTGGCTGCCCTCCTCTGCGG + Intronic
969795472 4:9524599-9524621 GCCTTAGCTGCCTCCCCGTGGGG - Intergenic
970391236 4:15615133-15615155 GCCTTAGCTGCCTTCCTGCGGGG + Intronic
970576851 4:17436707-17436729 GCCTTAGCTGCCTCCCCGTGGGG - Intergenic
970817873 4:20179174-20179196 GCCTTAGCTGCCTCCCCATGGGG - Intergenic
971709486 4:30092926-30092948 GCCTTAGCTGCCTTCCCGTGGGG + Intergenic
971811973 4:31438871-31438893 GCCTTAGCTGCCTTCCTGTAGGG + Intergenic
972022765 4:34335782-34335804 GCCTTAGCTGCCTTCCTGTGGGG - Intergenic
973048592 4:45567272-45567294 GCCTTAGCTGCCTCCCTGCGGGG + Intergenic
973587746 4:52409887-52409909 GCCTTAGCTGCCTTCCCGTGGGG - Intergenic
974329284 4:60455783-60455805 CCCTGGCCTGCCTCCCTCTGAGG + Intergenic
974641726 4:64640614-64640636 GCCTTAGCTGCCTTCCTGCGGGG - Intergenic
974839324 4:67282962-67282984 GCCTTAGCTGCCTCCCCATGGGG - Intergenic
974892279 4:67896703-67896725 GCCTTAGCTGCCTCCCTGCGAGG - Intergenic
975596346 4:76050798-76050820 GCCTTAGCTGCCTTCCTGCGGGG - Intronic
975754836 4:77562087-77562109 GCCTCAGCTGCCTCCCTGTGGGG + Intronic
975755890 4:77570883-77570905 GCCTTAGCTGCCTTCCCATGGGG + Intronic
975898453 4:79122152-79122174 GCCTTAGCCGCCTCCCTGTGGGG + Intergenic
976520607 4:86021748-86021770 GCCTTAGCTGCCTTCCTGCGGGG - Intronic
976736282 4:88313331-88313353 GCCTTAGCTGCCTCCCTGCGGGG - Intergenic
977470683 4:97438226-97438248 GCCTTAGCTGCCTCCCCATGGGG - Intronic
978080270 4:104582200-104582222 GCCTTAGCTGCCTTCCCGTGGGG + Intergenic
978873347 4:113607379-113607401 TGCTTGGCTGCCTACCTGTCAGG + Intronic
978998025 4:115179570-115179592 GCCTTAGCTGCCTTCCTGAGGGG - Intergenic
978999558 4:115200335-115200357 GCCTTAGCTGCCTTCCCATGGGG - Intergenic
979688610 4:123538136-123538158 GCCTTAGCTGCCTTCCCCCGGGG + Intergenic
979736297 4:124089999-124090021 GCCCTGCTTGCCTACTTCTGTGG - Intergenic
979987985 4:127338992-127339014 GCCTTGGATGCCTATCTCAATGG + Intergenic
979991482 4:127380154-127380176 GCCTTGGCTGCCTTCCCACGGGG + Intergenic
980739278 4:136929213-136929235 GCCTCAGCTGCCTCCCTGTGGGG + Intergenic
980799778 4:137733955-137733977 GCCTTAGCTGCCTTCCCGTGGGG + Intergenic
980815574 4:137942290-137942312 GCCTTGGCTGCCTTCCCACGGGG + Intergenic
980824094 4:138053083-138053105 GCCTTAGCTGCCTCCCTGAGGGG - Intergenic
981275836 4:142897716-142897738 GCCTTAGCTGCCTTCCCGTGGGG + Intergenic
982702612 4:158672643-158672665 ACCCTGGCTTCCTCCCTCTGGGG + Intronic
982728212 4:158927921-158927943 GCCTTAGCTGCCTTCCTGTGGGG + Intronic
982814562 4:159869174-159869196 GCCTTAGCTGCCTTCCCGTGGGG - Intergenic
982868785 4:160550249-160550271 GCCTTAGCTGCCTTCCCGTGGGG - Intergenic
983060355 4:163153065-163153087 GCCTTAGCTGCCTTCCTGCGGGG + Intronic
983230640 4:165126078-165126100 GCCTTAGCTGCCTTCCTGTGGGG - Intronic
983835378 4:172377677-172377699 GCCTCAGCTGCCTCCCTGTGGGG - Intronic
983859821 4:172691610-172691632 GCCTTGCCTGACCATCTCTGTGG - Intronic
984704743 4:182839534-182839556 GGCTTTGCTGCCTGTCTCTGGGG - Intergenic
984770586 4:183433364-183433386 GCCTTGGCTGCCTTCCCTCGGGG + Intergenic
985409149 4:189664878-189664900 GCCTCAGCTGCCTCCCTGTGGGG - Intergenic
985838013 5:2284535-2284557 CCCTTGGCTGCTCACCTCAGTGG + Intergenic
986152023 5:5138005-5138027 GCCTTAGCTGCCTTCCTGCGGGG + Intergenic
987876969 5:23691344-23691366 GCCTTAGCTGCCTTCCCGTGGGG + Intergenic
988177289 5:27743681-27743703 GCCTTAGCTGCCTTCCCGTGGGG + Intergenic
988291745 5:29296629-29296651 GCCTTAGCTGCCTCCCTGAGGGG - Intergenic
988915877 5:35893008-35893030 GCCTTAGCTGCCTTCCCGTGGGG - Intergenic
989342557 5:40392534-40392556 GCCATGGCTGGCTTCCTCAGTGG - Intergenic
989965848 5:50465234-50465256 GCCTTAGCTGCCTTCCTGCGGGG + Intergenic
990837342 5:60036758-60036780 GCCTGGGTTGCCTATCTCTGTGG + Intronic
991099382 5:62776024-62776046 GCCTTCGCTGACTGCCTCAGAGG + Intergenic
991214966 5:64150299-64150321 GCCTTAGCTGCCTCCCTACGGGG + Intergenic
991474243 5:67003257-67003279 GCCTTCTTTGTCTACCTCTGTGG + Intronic
992678220 5:79126996-79127018 GCCTTGCCTTTCTTCCTCTGTGG - Intronic
993031891 5:82714909-82714931 GCCTTAGCTGCCTTCCCGTGGGG + Intergenic
993678589 5:90847658-90847680 GCCTTAGCTGCCTCCCTGCGGGG - Intronic
993770309 5:91917496-91917518 GCCTTAGCTGCCTCCCCGTGGGG + Intergenic
993883086 5:93385535-93385557 GCATTTGCTGAGTACCTCTGGGG - Intergenic
994229985 5:97301368-97301390 GCCTTAGCTGCCTTCCCGTGAGG + Intergenic
994509822 5:100689009-100689031 GCCTTAGCTGCCTTCCTGCGGGG - Intergenic
994647745 5:102491531-102491553 GCCTTAGCTGCCTCCCTGTGGGG - Intronic
995032340 5:107494463-107494485 GCCTTAGCTGCCTTCCCGTGGGG + Intronic
995596438 5:113753259-113753281 GCCTTAGCTGCCTTCCTGCGGGG - Intergenic
995920422 5:117304882-117304904 GCCTTAGCTGCCTTCCTGCGGGG + Intergenic
996435712 5:123430769-123430791 GCCTTAGCTGCCTTCCCGTGGGG + Intergenic
996586004 5:125088879-125088901 GCCTTAGCTGCCTTCCCGTGGGG + Intergenic
997352225 5:133239162-133239184 GCCTTAGCTGCCTCCCTGCGGGG + Intronic
998370153 5:141655662-141655684 GCCTTTGCTGCCTATCCGTGGGG - Exonic
1000329168 5:160194037-160194059 GCCTTAGCTGCCTTCCCATGGGG - Intronic
1000364057 5:160474799-160474821 GCCTTAGATGCTTACCTCTGTGG - Intergenic
1000547630 5:162622063-162622085 GCCTTAGCTGCCTCCCCGTGGGG + Intergenic
1000925854 5:167193211-167193233 GCCTTGCCTGACTACAACTGCGG - Intergenic
1002305922 5:178282830-178282852 CCCTTGGCAGTCTATCTCTGGGG + Intronic
1002718335 5:181242991-181243013 GCCTCCTATGCCTACCTCTGAGG + Intronic
1003074101 6:2968612-2968634 CCCTGCGCTGCCTATCTCTGGGG + Intronic
1003490021 6:6613432-6613454 GCCTTGGCTGCCTCCCGGCGCGG - Intronic
1003717645 6:8665919-8665941 GCCTTAGCTGCCTTCCCGTGGGG - Intergenic
1003717722 6:8666189-8666211 GCCTTAGCTGCCTTCCCGTGGGG + Intergenic
1003956700 6:11171285-11171307 GCCTTAGCTGCCTCCCTGCGGGG + Intergenic
1004302301 6:14469638-14469660 GGCTTGCCTGTCTTCCTCTGTGG - Intergenic
1004338208 6:14783748-14783770 GCCTTAGCTGCCTCCCCGTGGGG - Intergenic
1004471007 6:15929086-15929108 CCCTTGGCTGCCTATAGCTGTGG + Intergenic
1004511664 6:16288474-16288496 GCCTTAGCTGCCTCCCTGCGGGG + Intronic
1005059306 6:21761378-21761400 GCCTTAGCTGCCTCCCCGTGGGG + Intergenic
1005561451 6:27045462-27045484 GCCTTAGCTGCCTTCCTGTGGGG + Intergenic
1005749906 6:28872733-28872755 GCCTTGGCTGCCTTCCCACGGGG - Intergenic
1006166882 6:32070457-32070479 TCCTTGACTGCCTCCCTCTGGGG + Intronic
1006477852 6:34269246-34269268 GCCTTAGCTGCCTTCCTGCGGGG + Intergenic
1006748878 6:36364372-36364394 GCCTTAGCTGCCTTCCTGCGGGG - Intronic
1007108094 6:39296970-39296992 GCCTTGGCTGACCCCCTCTCAGG - Intergenic
1007135027 6:39512487-39512509 GCCTTGGCTGCTTAGGTCTGAGG + Intronic
1007633891 6:43286771-43286793 GCCTCAACTGCCTACATCTGGGG + Exonic
1008038808 6:46774819-46774841 GCCTTGGCTGCCTTCCCGAGGGG + Intergenic
1008270164 6:49481964-49481986 GCCTTAGCTGCCTCCCTGTGGGG - Intronic
1008270473 6:49483559-49483581 GCCTTAGCTGCCTCCCTGTGGGG - Intronic
1008284324 6:49629689-49629711 GCCTTAGCTGCCTTCCCGTGGGG - Intronic
1009407088 6:63326594-63326616 GCCTTAGCTGCCTTCCTGTGGGG - Intergenic
1009470292 6:64023954-64023976 GCCTTGGCTGCCTTCCCGCGGGG + Intronic
1009471425 6:64031334-64031356 GCCTTAGCTGCCTTCCCATGGGG + Intronic
1009872285 6:69467422-69467444 GCCTTAGCTGCCTCCCTGCGGGG + Intergenic
1011338341 6:86284959-86284981 GCCTTAGCTGCCTTCCCATGGGG - Intergenic
1012145039 6:95670261-95670283 GCCTCAGCTGCCTCCCTGTGGGG + Intergenic
1013805505 6:113992031-113992053 GCCATGGTTGCCTAACCCTGGGG - Intronic
1014186454 6:118439820-118439842 GCCTTGGATGCCTGTGTCTGTGG + Intergenic
1014212713 6:118723135-118723157 GCCTAGCCAGACTACCTCTGTGG + Intergenic
1014499266 6:122165266-122165288 GCCTTAGCTGCCTTCCCATGGGG - Intergenic
1014788491 6:125644672-125644694 GCCTTAGCTGCCTTCCCGTGGGG + Intergenic
1015629708 6:135219601-135219623 CCCTTGGCTCCCTCCCTGTGAGG - Intergenic
1016069870 6:139726488-139726510 GCCTTAGCTGCCTTCCCGTGGGG - Intergenic
1016104709 6:140148262-140148284 GCCTTAGCTGCCTCCCCCGGGGG - Intergenic
1016482298 6:144495290-144495312 GCCTTAGCTGCCTTCCTGCGGGG - Intronic
1016859045 6:148698763-148698785 GCCTTAGCTGCCTCCCCCAGGGG - Intergenic
1019407009 7:889190-889212 GCCCTGGCTGCCTCCCACTGGGG + Intronic
1019489854 7:1307225-1307247 GCCTGTGCTGCCCACCTCTCCGG - Intergenic
1019944245 7:4314078-4314100 GCCTTAGCTGCCTTCCTGCGGGG - Intergenic
1020008290 7:4793704-4793726 GCCTTAGCTGCCTTCCTGCGGGG + Intronic
1021264311 7:18500436-18500458 GCCTTGGCTGTTAGCCTCTGAGG - Intronic
1021567399 7:22028860-22028882 GCCTTAGCTGCCTTCCCATGGGG + Intergenic
1021567876 7:22032507-22032529 GCCTTAGCTGCCTTCCCGTGGGG - Intergenic
1022725421 7:32976906-32976928 GCCTTGGCCACCAACCTCTCTGG + Intronic
1022750454 7:33219194-33219216 GCCTTAGCTGCCTTCCCGTGGGG + Intronic
1024335616 7:48203053-48203075 GCCTTAGCTGCCTTCCCGTGGGG - Intronic
1024741788 7:52362827-52362849 GCCTTAGCTGCCTTCCCGTGGGG + Intergenic
1024825406 7:53385301-53385323 GCCTTAGCTGCCTTCCTGCGGGG - Intergenic
1025048192 7:55710910-55710932 GCCTTGGCCACCAACCTCTCTGG - Intergenic
1026004743 7:66591928-66591950 TTCTTGGCCGCCTCCCTCTGCGG - Intergenic
1026512361 7:71037814-71037836 GCCTTAGCTGCCTTCCCGTGAGG + Intergenic
1026601959 7:71784706-71784728 ACCTTGGCTGCCCAACTGTGTGG - Exonic
1027579691 7:79977743-79977765 GCCTTAGCTGCCTTCCTGTGGGG - Intergenic
1027665911 7:81042928-81042950 GCCTTAGCTGCCTTCCCGTGGGG + Intergenic
1028142519 7:87288944-87288966 GCCTTAGCTGCCTTCCCATGGGG + Intergenic
1028719400 7:94012008-94012030 GCCTCAGCTGCCTCCCTGTGGGG - Intergenic
1029832355 7:103275065-103275087 GCCTTGGCTGCCTTCCCACGGGG - Intergenic
1029914888 7:104198973-104198995 GCCTTGGCGGCTTACATGTGGGG + Intronic
1030102115 7:105955949-105955971 GCCTTAGCTGCCTCCCTGCGGGG - Intronic
1031109980 7:117596322-117596344 GCCTTAGCTGCCTCCCTGCGGGG + Intronic
1031206936 7:118771888-118771910 GCTTTGACTTCCTGCCTCTGTGG + Intergenic
1032561584 7:132898747-132898769 GCCTTAGCTGCCTTCCCGTGGGG - Intronic
1032807003 7:135365486-135365508 TCCTTGTCTGCCTGCCTCTCAGG - Intronic
1032836772 7:135682255-135682277 GCCTTTGCTTCTTTCCTCTGAGG + Intronic
1033758602 7:144418109-144418131 GCCTTAGCTGCCTCCCCGTGGGG - Intergenic
1033839905 7:145360777-145360799 GCCTTAGCTGCCTCCCTGCGGGG - Intergenic
1034091066 7:148364028-148364050 GCCTTGGCTGCCTTCCCATGGGG + Intronic
1034097933 7:148426628-148426650 GCCTTAGCTGCCTTCCCGTGGGG + Intergenic
1034429147 7:151032223-151032245 GCCTTTCCTGACTCCCTCTGAGG + Intronic
1036260481 8:7235873-7235895 GCCTTAGCTGCCTCCCTGCGGGG + Intergenic
1036306133 8:7603649-7603671 GCCTTAGCTGCCTCCCTGCGGGG - Intergenic
1036312518 8:7694429-7694451 GCCTTAGCTGCCTCCCTGCGGGG + Intergenic
1036356979 8:8051634-8051656 GCCTTAGCTGCCTCCCTGCGGGG - Intergenic
1036831368 8:12022825-12022847 GCCTTAGCTGCCTCCCTGCGGGG + Intergenic
1036901592 8:12673628-12673650 GCCTTAGCTGCCTCCCCATGGGG + Intergenic
1037558957 8:20054947-20054969 GCCTTAGCTGCCTCCCTGTGGGG + Intergenic
1038012105 8:23483495-23483517 GCGTTCACTGTCTACCTCTGGGG - Intergenic
1038174088 8:25164716-25164738 GCCTTGGCTGCCTTCCCACGGGG + Intergenic
1038563674 8:28601666-28601688 GCCCTGGCAGCCTCCCTCAGGGG + Intronic
1038639423 8:29311685-29311707 GCCTTAGCTGCCTTCCTGCGGGG + Intergenic
1038870719 8:31490086-31490108 GCCTTAGCTGCCTTCCTGTGGGG + Intergenic
1039068752 8:33631897-33631919 GCCTTAGCTGCCTCCCTGTGGGG + Intergenic
1039637319 8:39180334-39180356 GCCTTAGCTGCCTTCCCATGGGG + Intronic
1040323966 8:46331909-46331931 GCCTTAGCTGCCTTCCCATGGGG + Intergenic
1040622216 8:49103151-49103173 GCCTTAGCTGCCTCCCCGTGGGG - Intergenic
1040734614 8:50490694-50490716 CCATTGCCTGCCTACCCCTGGGG - Intronic
1040942233 8:52845210-52845232 GGCGGGGCTGCCTCCCTCTGAGG - Intergenic
1040952690 8:52952997-52953019 GCCTTAGCTGCCTTCCTGCGGGG - Intergenic
1043346478 8:79303714-79303736 GCCTTAGCTGCCTTCCTGTGGGG + Intergenic
1043709901 8:83403162-83403184 GCCTTGGCTGCCTTCCCACGGGG + Intergenic
1044075839 8:87821054-87821076 GCCTTAGCTGCCTTCCCGTGGGG + Intergenic
1044853582 8:96452500-96452522 GCCTCAGCTGCCTCCCTGTGAGG + Intergenic
1044880649 8:96719227-96719249 GCCTTAGCTGCCTTCCTGCGGGG - Intronic
1046621226 8:116531264-116531286 GCCTTAGCTGCCTTCCTGCGGGG + Intergenic
1048344900 8:133569142-133569164 GCCTTTGTTGCCTACCTCCCTGG - Intronic
1048385959 8:133912735-133912757 GCCTTGGCTGTCTGCCTCCTGGG - Intergenic
1048676945 8:136793941-136793963 GCCTTAGCTGCCTCCCTGCGGGG - Intergenic
1049857942 8:144875346-144875368 GCCTTAGCTGCCTCCCCATGGGG + Intergenic
1051002418 9:12300507-12300529 ACCTTGGCTATTTACCTCTGAGG - Intergenic
1051305069 9:15700182-15700204 GCCTTAGCTGCCTTCCCGTGGGG - Intronic
1051449395 9:17178569-17178591 GCCTTAGCTGCCTCCCTGTGGGG - Intronic
1051459415 9:17294974-17294996 GCCTTAGCTGCCTCCCTGTGCGG - Intronic
1052892692 9:33719114-33719136 GCCTGGGGTTCCTTCCTCTGTGG + Intergenic
1052979563 9:34438144-34438166 GCCTTAGCTGCCTTCCTGCGGGG + Intronic
1053393430 9:37752097-37752119 GCCTTAGCTGCCTACCTGCGGGG + Intronic
1055049379 9:71963758-71963780 GCCTTAGCTGCCTTCCTGCGGGG + Intronic
1055461447 9:76523875-76523897 GCCTTAGCTGCCTTCCTGCGGGG - Intergenic
1055651391 9:78410216-78410238 GCCTTAGCTGCCTCCCCGTGGGG + Intergenic
1056404994 9:86265197-86265219 GCCTTCGCTGACTGCCTCAGAGG + Exonic
1057191005 9:93087684-93087706 CCCTTGGCTGCATGCCTCAGGGG + Intergenic
1057250771 9:93499950-93499972 GCTTTGGCTGCCTATGTATGTGG + Intronic
1057300713 9:93880116-93880138 GCCTTAGCTGCCTCCCTGCGGGG + Intergenic
1057303413 9:93899303-93899325 GCCTTGGCTGCCTTCCCCAGGGG - Intergenic
1057543843 9:96001860-96001882 GCCTTGGCTGCCTTCCCACGGGG - Intronic
1057769742 9:97957313-97957335 GCCTTGCCTGCCTGCCACTCAGG + Intergenic
1058053127 9:100426523-100426545 GCCTTCTCTGCCTTTCTCTGGGG + Intergenic
1058069469 9:100586986-100587008 GCCTCTGCTGCCTGCCTCAGAGG + Exonic
1058174849 9:101724256-101724278 GCCTTAGCTGCCTTCCTGTGGGG - Intronic
1058286581 9:103187122-103187144 GCCTTAGCTGCCTCCCTGCGGGG + Intergenic
1058786515 9:108393733-108393755 GCCTTAGCTGCCTTCCTGTGGGG + Intergenic
1060305368 9:122406337-122406359 GCCTTAGCTGCCTCCCCCCGGGG - Intergenic
1061062662 9:128258409-128258431 ACCTTTGCTGCCTCCCTCTGTGG - Intronic
1062735443 9:138134858-138134880 GCCCTGGCTGCCTGGCCCTGTGG + Intergenic
1203487799 Un_GL000224v1:73596-73618 TCCTTGGCTGTGTAACTCTGAGG + Intergenic
1203500420 Un_KI270741v1:15491-15513 TCCTTGGCTGTGTAACTCTGAGG + Intergenic
1203662395 Un_KI270753v1:57552-57574 GCCTCAGCTGCCTCCCTGTGGGG + Intergenic
1186295637 X:8145114-8145136 GCCTTAGCTGCCTTCCCGTGGGG - Intergenic
1187139068 X:16575672-16575694 GCCTTAGCTGCCTTCCCGTGGGG + Intergenic
1188189545 X:27157223-27157245 GCCTTAGCTGCCTTCCCATGGGG + Intergenic
1188523949 X:31070228-31070250 GTGTTGGCTGCCTTCCTGTGAGG + Intergenic
1189896832 X:45664962-45664984 GGCTTAGCTGCCTCCCCCTGGGG - Intergenic
1190214425 X:48470228-48470250 GCCCTCCCTGCCTCCCTCTGGGG - Intronic
1190844948 X:54182966-54182988 GCCTTGGGTGCCTACTCCGGGGG - Exonic
1191192359 X:57680112-57680134 GCCTTGTCTACCTATGTCTGGGG + Intergenic
1191690006 X:63929852-63929874 GCTTTGGCAGGCTTCCTCTGGGG - Intergenic
1192189283 X:68980948-68980970 GCTATGGCTGCCTATCTCTGAGG - Intergenic
1192870552 X:75179659-75179681 GCCTTAGCTGCCTTCCCGTGGGG - Intergenic
1193708959 X:84856789-84856811 GCCTTAGCTGCCTTCCCATGGGG - Intergenic
1193951758 X:87808848-87808870 GCCTTAGCTGCCTTCCTGCGGGG - Intergenic
1195259355 X:103117252-103117274 GCCTTAGCTGCCTTCCCATGGGG - Intergenic
1196582710 X:117394900-117394922 GCCTTAGCTGCCTTCCCGTGGGG + Intergenic
1196616146 X:117769232-117769254 GCCTTAGTTGCCTCCCTGTGGGG + Intergenic
1196662514 X:118282883-118282905 GCCTTAGCTGCGTTCCTGTGGGG - Intergenic
1196762332 X:119211021-119211043 GCCTTAGCTGCCTTCCCGTGGGG - Intergenic
1196781451 X:119387726-119387748 GCCTTAGCTGCCTTCCTGCGGGG - Intergenic
1198060932 X:133044596-133044618 GCCTTAGCTGCCTCCCCGTGGGG + Intronic
1198468117 X:136921585-136921607 GCCTTAGCTGCCTCCCTGTGGGG + Intergenic
1198664296 X:139004167-139004189 GCCTTAGCTGCCTTCCTGCGGGG - Intronic
1198671457 X:139085066-139085088 GTCTAGGCTGGCTTCCTCTGGGG - Intronic
1198694463 X:139321021-139321043 GCCTTAGCTGCCTCCCCGTGGGG + Intergenic
1199815876 X:151396679-151396701 GGCTTGACTTCCTACCACTGCGG + Intronic
1199831266 X:151551329-151551351 GCCTTAGCTGCCTTCCAGTGGGG - Intergenic
1199833022 X:151562965-151562987 GCCTTAGCTGCCTCCCTGTGGGG - Intergenic
1201265055 Y:12198310-12198332 GTCTTTGCTGTCTGCCTCTGAGG + Intergenic
1201429195 Y:13888038-13888060 GCCTTAGCTGCCTCCCCGTGGGG + Intergenic
1201488175 Y:14513033-14513055 GCCTCAGCTGCCTTCCTCTGGGG + Intergenic
1202272645 Y:23085902-23085924 GCCTTAGCTGCCTCCCCGTGCGG - Intergenic
1202293381 Y:23334780-23334802 GCCTTAGCTGCCTCCCCGTGCGG + Intergenic
1202425642 Y:24719646-24719668 GCCTTAGCTGCCTCCCCGTGCGG - Intergenic
1202445147 Y:24950439-24950461 GCCTTAGCTGCCTCCCCGTGCGG + Intergenic