ID: 1183292489

View in Genome Browser
Species Human (GRCh38)
Location 22:37011259-37011281
Sequence ATGGACTTCCTGACTGAGGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 145}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183292489_1183292494 2 Left 1183292489 22:37011259-37011281 CCATCCTCAGTCAGGAAGTCCAT 0: 1
1: 0
2: 1
3: 13
4: 145
Right 1183292494 22:37011284-37011306 AAGGCATGTTGACGGCACCACGG 0: 1
1: 0
2: 3
3: 6
4: 77
1183292489_1183292492 -6 Left 1183292489 22:37011259-37011281 CCATCCTCAGTCAGGAAGTCCAT 0: 1
1: 0
2: 1
3: 13
4: 145
Right 1183292492 22:37011276-37011298 GTCCATGAAAGGCATGTTGACGG 0: 1
1: 0
2: 0
3: 18
4: 190
1183292489_1183292499 30 Left 1183292489 22:37011259-37011281 CCATCCTCAGTCAGGAAGTCCAT 0: 1
1: 0
2: 1
3: 13
4: 145
Right 1183292499 22:37011312-37011334 GCCCGAGTCCAGTCCTGGGCAGG 0: 1
1: 0
2: 2
3: 10
4: 226
1183292489_1183292495 8 Left 1183292489 22:37011259-37011281 CCATCCTCAGTCAGGAAGTCCAT 0: 1
1: 0
2: 1
3: 13
4: 145
Right 1183292495 22:37011290-37011312 TGTTGACGGCACCACGGATATGG 0: 1
1: 0
2: 0
3: 2
4: 31
1183292489_1183292497 25 Left 1183292489 22:37011259-37011281 CCATCCTCAGTCAGGAAGTCCAT 0: 1
1: 0
2: 1
3: 13
4: 145
Right 1183292497 22:37011307-37011329 ATATGGCCCGAGTCCAGTCCTGG 0: 1
1: 0
2: 0
3: 2
4: 62
1183292489_1183292498 26 Left 1183292489 22:37011259-37011281 CCATCCTCAGTCAGGAAGTCCAT 0: 1
1: 0
2: 1
3: 13
4: 145
Right 1183292498 22:37011308-37011330 TATGGCCCGAGTCCAGTCCTGGG 0: 1
1: 0
2: 0
3: 7
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183292489 Original CRISPR ATGGACTTCCTGACTGAGGA TGG (reversed) Exonic
902883351 1:19387391-19387413 AAGGAAGTCCTGGCTGAGGAAGG + Intronic
902992756 1:20200792-20200814 ATGGAATCACAGACTGAGGATGG + Intergenic
905989890 1:42327349-42327371 TTGGCCTTTCTGAATGAGGATGG - Intronic
906537197 1:46558020-46558042 TTTGATTTCCTGAATGAGGAAGG + Exonic
912939886 1:114035414-114035436 AAGAATATCCTGACTGAGGAAGG + Intergenic
917595428 1:176524563-176524585 AAAGACTTCCTGAAGGAGGAAGG + Intronic
918427235 1:184423232-184423254 GTGAAGTTCCTGAATGAGGAAGG - Intronic
918985499 1:191620156-191620178 ATGGCCTTCCTTACTGTGGTTGG + Intergenic
921160977 1:212472036-212472058 GGGGACTTCCTGCCTGAAGACGG - Intergenic
921269759 1:213457023-213457045 AAGGACTTCCTGACACAGAAAGG + Intergenic
922152643 1:223018680-223018702 GAGAACTGCCTGACTGAGGATGG + Intergenic
923309167 1:232718729-232718751 ATGGACGTCCTGAACGAGGCGGG - Intergenic
923349530 1:233089975-233089997 AGGGACCTCCTAACAGAGGAAGG + Intronic
1066078281 10:31903354-31903376 ATGGACTGCATGAATGATGACGG - Intronic
1070268905 10:74932721-74932743 ATGTACCACCTGAATGAGGATGG + Intronic
1071106855 10:82108042-82108064 ATGGGCTTCCTGCCTGAGGTTGG + Intronic
1071371536 10:84956655-84956677 AGGAACTTCCAGACTGAGCAAGG - Intergenic
1074201459 10:111239776-111239798 TAGGACTTCCTTAGTGAGGAAGG - Intergenic
1074418981 10:113292753-113292775 AGGCACTTCCAGACTGATGAAGG + Intergenic
1074828042 10:117228651-117228673 TTTGGCTTCCTGAGTGAGGAAGG - Intergenic
1079320053 11:19444349-19444371 ATGGAGTTCCTGGCTGGGCAGGG - Intronic
1079833220 11:25298105-25298127 TTAGCCTTACTGACTGAGGATGG - Intergenic
1080313116 11:30917724-30917746 GAGGACTGCTTGACTGAGGAAGG + Intronic
1082914851 11:58422140-58422162 ATGTAATACCTGAATGAGGAAGG - Intergenic
1083768452 11:64853440-64853462 TTGCATTTCCTGGCTGAGGAAGG - Exonic
1090155577 11:124434694-124434716 ATGGACTTGCTGTCTGTGAATGG - Intergenic
1092938435 12:13385720-13385742 ATGGACCTCCTGCCAGAGAATGG + Intronic
1095939667 12:47717804-47717826 AAGGACTTCCTGACTGTGAAGGG - Intronic
1096643786 12:53016511-53016533 ACAGACTTTCTGGCTGAGGATGG + Exonic
1097819062 12:64109025-64109047 AGGTACTTACTGATTGAGGAAGG - Exonic
1101230870 12:102739708-102739730 ATGGAATTTCTGATTGAGGTTGG + Intergenic
1103102094 12:118186615-118186637 ATGAACTTCCTTACAGAAGAAGG + Intronic
1106998401 13:35515294-35515316 CTGAAATTCCAGACTGAGGAGGG + Intronic
1108336044 13:49443564-49443586 ATGAACTGCCTGATTGAGAAAGG - Intronic
1113426540 13:110213096-110213118 ATGGACTTCGGGACTCAGGTGGG + Intronic
1113452414 13:110420663-110420685 CGGGACTTTTTGACTGAGGATGG + Intronic
1113626602 13:111852510-111852532 ATGGACTAGGGGACTGAGGAAGG + Intergenic
1114621862 14:24100947-24100969 CTGGACTGCCTGACTGCAGAAGG - Intronic
1115216488 14:31018530-31018552 AAGGACATCCTGGCTGAAGAGGG + Intronic
1116935462 14:50735113-50735135 ATGGATTTCCCAACTGAAGAGGG + Intronic
1117286854 14:54294087-54294109 ATGGTCTGCCTGCCTGAGGATGG + Intergenic
1118040559 14:61911457-61911479 ATTGCCTTGCTGAATGAGGATGG - Intergenic
1118682224 14:68254346-68254368 ATGGATCTGCTGACTGTGGAGGG - Intronic
1118746298 14:68775974-68775996 AGCTACTTCCTGACTGAGGTGGG - Intergenic
1119648819 14:76368665-76368687 ATAGAATTCCTGACTTGGGAGGG - Intronic
1119673933 14:76539657-76539679 ATGCACTTCCTGTCGGAGGCTGG - Intergenic
1120433283 14:84446627-84446649 ATGAACTCCCTGGCTGAGAATGG - Intergenic
1125375547 15:39024991-39025013 ACGGGCTTCCTGAAAGAGGAAGG + Intergenic
1128156940 15:65396977-65396999 ATGGGCTTCCCGTCTGGGGAAGG + Exonic
1128329080 15:66744235-66744257 AGCGACTTCCTGCCAGAGGAAGG + Intronic
1128649474 15:69400147-69400169 ATTGCCCTCCTGACTGGGGAGGG + Intronic
1129207414 15:74045265-74045287 AGGGAGGTCCTGAGTGAGGAAGG + Exonic
1130652523 15:85770140-85770162 ACGGTGTTCCTGACTGAGGCTGG + Intronic
1133506942 16:6421843-6421865 ATGGGATTTGTGACTGAGGAGGG - Intronic
1135486796 16:22872698-22872720 ATGGACTGCCTCATTGAGGATGG + Intronic
1136083668 16:27869129-27869151 ATGGGGCTCCTCACTGAGGATGG + Intronic
1137024200 16:35456830-35456852 AGGAACTTCCTGTCTTAGGAGGG - Intergenic
1138578495 16:57923971-57923993 TTGGACTTCCTGACTGATGGAGG - Intronic
1141044804 16:80706536-80706558 AAGGAATTCATGACTGAGGCTGG + Intronic
1145862389 17:28221730-28221752 ATGGTCTCCCTGACTTAGGGTGG + Intergenic
1147893988 17:43738432-43738454 ATGCTCATCCTTACTGAGGAGGG - Intergenic
1148456066 17:47812222-47812244 ATCGGCTTCCTGCGTGAGGAAGG - Intronic
1151419864 17:73990176-73990198 ATGGAACACCTGACTGGGGAAGG + Intergenic
1152665521 17:81566657-81566679 ATAGGCTTCCTGACAGAGAAAGG + Intronic
1152688267 17:81705554-81705576 ACGGCCTTCCTGGCGGAGGACGG + Intronic
1152798120 17:82317804-82317826 AGGGACTCCCTGGCTGGGGACGG + Intergenic
1153271563 18:3327413-3327435 ATGGACCTCCAGAATCAGGAAGG + Intergenic
1155550227 18:26956992-26957014 ATTCACTTGCTGACTGAGGAAGG + Intronic
1156864190 18:41870455-41870477 ATGGGCTTCTTGGCTGAGGGTGG - Intergenic
1157416147 18:47504851-47504873 TTGGACTTCCTCTCTGAGAAAGG - Intergenic
1158161258 18:54486305-54486327 ATCCACTTCATGGCTGAGGAAGG - Intergenic
1162782026 19:13011489-13011511 ATGGACTTCAGGAGTGAGGGTGG + Intronic
1164590835 19:29505978-29506000 TTGGACTCCCTAAGTGAGGAGGG + Intergenic
1165423131 19:35732201-35732223 ATGGACTTCCTGTGGGGGGAGGG - Exonic
1167110330 19:47456963-47456985 GTGGACTACCGCACTGAGGACGG - Exonic
925541081 2:4968485-4968507 ATGGCCTTCCTACATGAGGAAGG + Intergenic
925961518 2:9021602-9021624 ATGGATGTCCTGGCTCAGGAAGG + Intergenic
926355115 2:12034371-12034393 ATGGATGACCTGAGTGAGGACGG - Intergenic
930511398 2:52349827-52349849 AAAGACTTCCTGAGTGAGGGGGG - Intergenic
932501332 2:72185433-72185455 ATGAACTTCCTGAAGCAGGATGG + Intronic
938734662 2:134175446-134175468 GTGTACCTCCTGTCTGAGGAAGG + Intronic
938811628 2:134858983-134859005 CTGGGCTGCCTGACTGAGAATGG - Intronic
941474214 2:165928396-165928418 ATGGACTTCCAGAATAAGGGAGG + Intronic
948740139 2:240041112-240041134 AGGGAGGTCCTGACTGTGGATGG + Intergenic
1170348192 20:15410507-15410529 ATGGACTTGATGACTGTTGATGG - Intronic
1173656909 20:44705747-44705769 CTGGATATCCTGACTGATGAAGG + Intergenic
1174409323 20:50323300-50323322 ATGGCCTGCCTTACAGAGGAGGG + Intergenic
1178689863 21:34741916-34741938 ATGGACCCCCTCACTGAGGTGGG + Intergenic
1179731076 21:43367766-43367788 AAGGCCTTCCAGGCTGAGGAAGG + Intergenic
1180713279 22:17854546-17854568 ATGGATTTCCTGTCTGTGGACGG - Intronic
1181336391 22:22133863-22133885 ATGGAGTTCCTAGCTGAGGTGGG + Intergenic
1182058834 22:27382284-27382306 TTGGACTGACTGACTGAGGCTGG + Intergenic
1183292489 22:37011259-37011281 ATGGACTTCCTGACTGAGGATGG - Exonic
1183910364 22:41074695-41074717 ATGGAGATCCTCACTGAGCACGG - Intergenic
1185009897 22:48307024-48307046 ATGGTCTTCCAGACAGTGGAAGG - Intergenic
949182478 3:1150929-1150951 CTAGACTTCAGGACTGAGGAAGG + Intronic
949952166 3:9238314-9238336 ATGCCCTCCCTGACTGAGGAGGG - Intronic
950540610 3:13610085-13610107 AGGGACAGCCTCACTGAGGAGGG + Intronic
953365455 3:42340603-42340625 ATAGACTTTCTGACTGAGGAAGG + Intergenic
953435440 3:42874067-42874089 CTGGACTTCCTGTGAGAGGAGGG + Exonic
956784351 3:72630100-72630122 AAGGACTGCCTGGCTGAGGCTGG + Intergenic
959628395 3:108480174-108480196 CTGGACTGCATGACTGGGGAAGG + Intronic
960912166 3:122660664-122660686 ACAGACTTTCTGGCTGAGGATGG + Intergenic
969888845 4:10240855-10240877 GTGCCCTTCCAGACTGAGGATGG + Intergenic
974901217 4:68000805-68000827 ATGGAAGTCCTCTCTGAGGAGGG - Intergenic
975746392 4:77479681-77479703 ATGGAATTCTTAACTGAGGAAGG + Intergenic
975893917 4:79063045-79063067 ATGACCTTCCTGGCTGGGGAAGG + Intergenic
978168686 4:105642061-105642083 ATTGACTTCCTGGCTGAGATGGG + Intronic
980099220 4:128524530-128524552 ATCTACTTCCTGACTGGAGAAGG + Intergenic
980107884 4:128605550-128605572 ATGGACTTACTGAAGGGGGACGG - Intergenic
981507995 4:145524053-145524075 AAGAACTTCCAGACTGAGCATGG - Intronic
982538289 4:156634843-156634865 ATGCATTTCCTGACTGTGGTCGG - Exonic
982684989 4:158477445-158477467 AGGAATTTACTGACTGAGGAGGG + Intronic
986151134 5:5131353-5131375 GTGGCCTTCCTGACTAGGGATGG - Intergenic
989424286 5:41278049-41278071 ATGCACTTGCTGGCAGAGGAGGG + Intergenic
992162412 5:74016139-74016161 GTGGAGTTTCAGACTGAGGAGGG - Intergenic
994332872 5:98527734-98527756 ATGGAATTCCAGGCTTAGGAAGG - Intergenic
995372360 5:111433246-111433268 AAGGGCTTGATGACTGAGGAAGG + Intronic
995682882 5:114740462-114740484 ATGCACTTCCTGGCTCTGGAGGG - Intergenic
997064714 5:130547281-130547303 ATGGGCCTCCTAACAGAGGAGGG - Intergenic
997817433 5:137032843-137032865 ATGGACTTGAAGGCTGAGGATGG + Intronic
1004249559 6:14012392-14012414 ATGCCCTTCCACACTGAGGAGGG + Intergenic
1007932203 6:45701839-45701861 ATAGACCTCCTGACTAAGGTAGG + Intergenic
1008326335 6:50186732-50186754 ATGAACTTCCTGACAGAGAAGGG + Intergenic
1012754582 6:103210200-103210222 AGGGACTTGCTGACAGGGGAGGG + Intergenic
1012935286 6:105361503-105361525 ATGCACTTTCAAACTGAGGAAGG + Intronic
1016950671 6:149576743-149576765 ATTGACTTCCTTACTGTGGTAGG - Intronic
1017893076 6:158655305-158655327 ATGGGCTTCCTGCCCTAGGAAGG + Intronic
1020659588 7:10966299-10966321 CAGGACTACCTGCCTGAGGATGG - Intergenic
1021404532 7:20249537-20249559 ATAAACTTTCTCACTGAGGAGGG + Intergenic
1025027904 7:55533337-55533359 ATGCCCTTCCTGAGTGGGGAAGG - Intronic
1025106356 7:56174806-56174828 TGGGACTTCCTGACTGCAGACGG - Intergenic
1028980235 7:96960034-96960056 ATGCATTGCCTAACTGAGGAAGG - Intergenic
1029958739 7:104667800-104667822 ACAGACTTTCTGGCTGAGGATGG + Intronic
1034268265 7:149791482-149791504 ATGGGCAGCCTGACTGTGGAAGG + Intergenic
1036220946 8:6921276-6921298 ATGGTCTTCCATAATGAGGAGGG - Intergenic
1039749625 8:40465112-40465134 GTTTACTTCCTCACTGAGGAAGG - Intergenic
1040550286 8:48432187-48432209 ATGGGCTTCCTGGAGGAGGAGGG + Intergenic
1041557579 8:59175150-59175172 GTCTACTTCCTGACTAAGGAAGG + Intergenic
1043400556 8:79880176-79880198 ATGCACTTCCTGGCTGGAGAAGG - Intergenic
1045542646 8:103101320-103101342 ATGGGCAGCCAGACTGAGGAGGG + Intergenic
1047825125 8:128565058-128565080 ATGGATTAACTAACTGAGGATGG + Intergenic
1048369501 8:133765376-133765398 ATGGGTCTCCTCACTGAGGAAGG - Intergenic
1049199707 8:141334087-141334109 AAGGACTTCCTGGAGGAGGAGGG + Intergenic
1049350037 8:142159534-142159556 ATGGAATTCCTAAATGAGGAAGG + Intergenic
1050533308 9:6609205-6609227 GTGGACTTACTGAATCAGGATGG - Intronic
1051406462 9:16742983-16743005 ATGGACCTCATGAGTGAGAAAGG + Intronic
1052965283 9:34335967-34335989 ATGGAGTTCCTGTCTTAGGCAGG + Intronic
1057205127 9:93167311-93167333 ATGGAATCGCTGGCTGAGGATGG - Intergenic
1057319135 9:93996220-93996242 ATGAACTTCATGACTGGGCATGG + Intergenic
1057563307 9:96146058-96146080 ACAGACTTTCTGGCTGAGGATGG + Intergenic
1058639370 9:107068172-107068194 TTGGTCTCCCTGACTGAGGCAGG + Intergenic
1060749897 9:126162326-126162348 TTGGACTGTCTGACTGAGGTGGG + Intergenic
1186408879 X:9328439-9328461 ATGGACTACCTCAATAAGGAAGG + Intergenic
1187633644 X:21203044-21203066 AAAGACTGGCTGACTGAGGAAGG + Intergenic
1187798934 X:23038033-23038055 ATGGCTTTCCTGAATGAGGAGGG + Intergenic
1188484548 X:30668852-30668874 ATGGAAGTCCTGAGAGAGGATGG + Intronic
1196080092 X:111621416-111621438 ACAGACTTTCTGGCTGAGGATGG - Intergenic
1198317014 X:135478112-135478134 AGGGACTTCCTGACTGAAAATGG - Intergenic
1201219900 Y:11758534-11758556 AGGGATTTCCTGACTGATCAAGG + Intergenic