ID: 1183293724

View in Genome Browser
Species Human (GRCh38)
Location 22:37018232-37018254
Sequence CTGCTCGTAGGTCTTGAGCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 86}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183293717_1183293724 14 Left 1183293717 22:37018195-37018217 CCAGCTGGAACCTCTTAGATTCA 0: 1
1: 0
2: 0
3: 6
4: 105
Right 1183293724 22:37018232-37018254 CTGCTCGTAGGTCTTGAGCAGGG 0: 1
1: 0
2: 0
3: 5
4: 86
1183293716_1183293724 17 Left 1183293716 22:37018192-37018214 CCACCAGCTGGAACCTCTTAGAT 0: 1
1: 0
2: 0
3: 16
4: 140
Right 1183293724 22:37018232-37018254 CTGCTCGTAGGTCTTGAGCAGGG 0: 1
1: 0
2: 0
3: 5
4: 86
1183293715_1183293724 25 Left 1183293715 22:37018184-37018206 CCTTGAATCCACCAGCTGGAACC 0: 1
1: 1
2: 4
3: 67
4: 460
Right 1183293724 22:37018232-37018254 CTGCTCGTAGGTCTTGAGCAGGG 0: 1
1: 0
2: 0
3: 5
4: 86
1183293719_1183293724 4 Left 1183293719 22:37018205-37018227 CCTCTTAGATTCAAGGTTCTCCA 0: 1
1: 0
2: 2
3: 14
4: 150
Right 1183293724 22:37018232-37018254 CTGCTCGTAGGTCTTGAGCAGGG 0: 1
1: 0
2: 0
3: 5
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183293724 Original CRISPR CTGCTCGTAGGTCTTGAGCA GGG Exonic
901164330 1:7206975-7206997 CTGCTGGTAGGAGTTGAGAATGG + Intronic
904130575 1:28272582-28272604 GTGCTCGCCGGTCTTCAGCAAGG - Exonic
907497423 1:54854115-54854137 CTGCTCGTACAGCTTGCGCAGGG + Exonic
910282324 1:85514851-85514873 CTGATTCTAGGTGTTGAGCATGG - Intronic
913086857 1:115446896-115446918 TTGCTTGTTGGTCTTGAGGATGG + Intergenic
914207764 1:145549041-145549063 CTGATTCTAGGTGTTGAGCATGG + Intergenic
915944053 1:160136890-160136912 CTGCTCATAGGTCTGGAGGGAGG - Exonic
918422690 1:184380153-184380175 CAGCTAGTAAGTCTTTAGCATGG - Intergenic
922313510 1:224419578-224419600 TTGCACGTAGGTCTTCTGCATGG + Exonic
923636528 1:235702894-235702916 CTGCCCGTAGGTTTTTATCATGG + Exonic
1066408900 10:35146363-35146385 CTGCTAGTGTGTCTTGAGAAGGG - Intronic
1066707964 10:38201913-38201935 CTCATGGTAGATCTTGAGCAGGG + Intergenic
1067690235 10:48497114-48497136 CTGCTCTTAGGTGGTGATCATGG + Intronic
1068720224 10:60237026-60237048 AAGCTGGTAGGTCTGGAGCAGGG - Intronic
1069563264 10:69446296-69446318 CTGCTCTCAGATCTTTAGCAGGG + Intergenic
1071388268 10:85143751-85143773 CTACTCATAGATCTTTAGCAAGG + Intergenic
1071439567 10:85678424-85678446 CTGCTCCTAGGGCATGAGAAAGG - Intronic
1076904710 10:133356148-133356170 CCACTGGCAGGTCTTGAGCAGGG - Intronic
1079157248 11:17959510-17959532 CTGTTCGGTGGTCTTGAACAGGG + Exonic
1079238453 11:18706109-18706131 CTTCTCGTAGGGCTTGAGCTTGG + Exonic
1084755996 11:71239055-71239077 ATGCTCAGGGGTCTTGAGCAAGG + Intronic
1086190672 11:84074873-84074895 GAGCTCGTAGGTCTTAAGTAAGG - Intronic
1089923396 11:122231602-122231624 CTGCCTATAGGTCTGGAGCAGGG - Intergenic
1090405497 11:126473689-126473711 CTCCTGGCAGGTCCTGAGCAGGG - Intronic
1097931290 12:65189858-65189880 CTACTGGTAAGTCTTCAGCATGG - Intronic
1102183722 12:110932043-110932065 CTGCTCGTAGAGTTTGAGGATGG + Intergenic
1104230251 12:126877558-126877580 CTGCTGGTATATCTTGAGCCAGG + Intergenic
1107954615 13:45498957-45498979 CTGACCGTAGGTCTGGAGCAAGG - Intronic
1119078003 14:71663788-71663810 CTGCCCACATGTCTTGAGCAGGG - Intronic
1120495889 14:85234751-85234773 CTGCTCGATGGTCTTGTGGATGG - Intergenic
1128838735 15:70832377-70832399 CTGCTCCAAGGACTTGTGCACGG + Exonic
1129506176 15:76083343-76083365 CTGCTCCTTGGTCTCGAGCAAGG + Intronic
1129958805 15:79664499-79664521 CCATTCGAAGGTCTTGAGCAAGG + Intergenic
1131304422 15:91228989-91229011 TAGCTCGTAAGTGTTGAGCAGGG + Intronic
1131484398 15:92808464-92808486 CTGAACGTTTGTCTTGAGCAAGG - Intronic
1133353272 16:5117129-5117151 ATGCTCGTGGGTTGTGAGCAAGG + Intergenic
1139262136 16:65604548-65604570 CTTTTCATAGGTGTTGAGCACGG + Intergenic
1141089666 16:81121554-81121576 ATGCTCATAGCTCATGAGCAGGG - Intergenic
1142324849 16:89408126-89408148 CAGCTCGAAGGACTTGCGCATGG + Intronic
1144997877 17:19283275-19283297 CTTCTCGGAGATCATGAGCATGG + Exonic
1149543672 17:57487581-57487603 CTGCTGCCAGGTATTGAGCAGGG - Intronic
1157340266 18:46771869-46771891 GTGCTAGTAGGGCCTGAGCATGG - Intergenic
1159782406 18:72675450-72675472 TTGCTAGAAGGTCATGAGCAAGG - Intergenic
1159980531 18:74773942-74773964 CTGATTGCAGGTCTGGAGCATGG + Intronic
1162503261 19:11066770-11066792 CTGCTCTGGGGTCTGGAGCAAGG + Intergenic
1163943471 19:20515553-20515575 CTGAGCGTTGGTCTTGAGAATGG - Intergenic
1167198930 19:48050511-48050533 CTGCTGTTAAGTTTTGAGCAGGG - Intronic
925355809 2:3240286-3240308 CTGCTCGCTGTTCTTGAGGAAGG - Intronic
925355931 2:3241159-3241181 CTGCTCGCTGTTCTTGAGGAAGG - Intronic
927011430 2:18908647-18908669 CTGCCTCTAGGTCATGAGCAGGG + Intergenic
927335105 2:21912529-21912551 AAGCTCGTATTTCTTGAGCAAGG + Intergenic
937289000 2:120770642-120770664 GTGCTCTGAGGTCTTGGGCAAGG + Intronic
938207855 2:129439145-129439167 CTGCTTGTGAGTCTTGGGCAAGG + Intergenic
1169207164 20:3747096-3747118 ATGCTCAAAGGTCTAGAGCAAGG + Intronic
1170078595 20:12447932-12447954 CTTCACGTAGTTCTTGAGCCTGG + Intergenic
1173876014 20:46372052-46372074 CTGCCCCAGGGTCTTGAGCAGGG + Intronic
1177969052 21:27765731-27765753 TTTCTCATAGGTCTGGAGCATGG + Intergenic
1179937743 21:44615894-44615916 CTGCTGGGAGGTCTTCATCAAGG + Intronic
1182637067 22:31736590-31736612 CTGATGGTGGGTCTAGAGCAGGG + Intronic
1182697716 22:32207631-32207653 CTCCTGGTAGGTCCTGAGCCAGG + Intergenic
1182785725 22:32906033-32906055 CTGCTCCTAGGTCTTTCCCATGG - Intronic
1183195625 22:36351676-36351698 TTGCTGCAAGGTCTTGAGCAGGG - Intronic
1183293724 22:37018232-37018254 CTGCTCGTAGGTCTTGAGCAGGG + Exonic
1183295096 22:37024697-37024719 GTCCTCGTAGGTCTTGATGAAGG - Exonic
952117698 3:30202390-30202412 CTGCTTGGTGGTCTTAAGCAGGG - Intergenic
954685888 3:52369964-52369986 CTCCTCATAGGGCTTCAGCAAGG - Exonic
959858649 3:111191444-111191466 CTGCTCGAGGGTGTTGTGCAAGG + Intronic
960066426 3:113378526-113378548 CTGGTCCTAGGTCTTTAGCCAGG - Intronic
961148288 3:124613868-124613890 CTGCTCTTGAGTCTTGAGTATGG - Intronic
963356800 3:144218132-144218154 CTGCTTTCAGGTCTGGAGCAGGG + Intergenic
979795679 4:124843849-124843871 TTGTTTGTAGGTCTTGAGGATGG + Intergenic
990298466 5:54426756-54426778 CTGCTCCTAGCTCTTCAGCGAGG - Intergenic
995183604 5:109250576-109250598 CTGCTCCTAGGCATTGAGCAAGG + Intergenic
997653654 5:135539715-135539737 CTGCTCCTGGCTCTTGGGCAGGG + Intergenic
1001663634 5:173414693-173414715 TTGCTTTTAGGTCTTCAGCAAGG + Intergenic
1002846573 6:951080-951102 CTGCTGGAAGCTCTTGAGCAAGG - Intergenic
1019805749 7:3122852-3122874 CTTCACGTAGTTCTTGAGCTTGG - Intergenic
1021455546 7:20826343-20826365 ATGCTGGGAGGTGTTGAGCAGGG - Intergenic
1022096735 7:27145905-27145927 CTGCTCGTAGGTGCTGTGTATGG - Exonic
1024115839 7:46192288-46192310 CTGCTCCCAGTTCCTGAGCATGG + Intergenic
1036960749 8:13242111-13242133 CTGCTCGTATCTGTTGAGTAAGG + Intronic
1039274905 8:35924693-35924715 CAACTTGTAGGTTTTGAGCAAGG + Intergenic
1049441869 8:142613231-142613253 CTGCTCCAGGGTCTTGGGCAGGG + Exonic
1050085391 9:1959775-1959797 CTGCTCCAAGGACATGAGCAAGG + Intergenic
1056672421 9:88641917-88641939 CTGGTCCCAGGTCTGGAGCAGGG - Intergenic
1058750902 9:108037478-108037500 CTGAGCGTAGATGTTGAGCAGGG + Intergenic
1059527147 9:115002680-115002702 CTGCTTCTAGGTCTTGTCCATGG - Intergenic
1188506255 X:30888608-30888630 CTGTTGGTAGGTGTTGAGTAAGG - Intronic
1189554187 X:42125408-42125430 TTGCTCTTAGTTCTTGAGCCTGG + Intergenic
1189698233 X:43688054-43688076 CCGTTGGAAGGTCTTGAGCAGGG - Intronic
1198935904 X:141902960-141902982 CTGCTAGGAGGCCTTGGGCAGGG + Intergenic
1201635584 Y:16119521-16119543 CTTCACGTAGTTCTTGAGCCTGG + Intergenic