ID: 1183293794

View in Genome Browser
Species Human (GRCh38)
Location 22:37018594-37018616
Sequence AGGCACCCGAGAGGCCCGCA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 101}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183293794_1183293800 10 Left 1183293794 22:37018594-37018616 CCTTGCGGGCCTCTCGGGTGCCT 0: 1
1: 0
2: 0
3: 8
4: 101
Right 1183293800 22:37018627-37018649 AGGACGCGTCCAGCACCCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 51
1183293794_1183293802 15 Left 1183293794 22:37018594-37018616 CCTTGCGGGCCTCTCGGGTGCCT 0: 1
1: 0
2: 0
3: 8
4: 101
Right 1183293802 22:37018632-37018654 GCGTCCAGCACCCGCAGGCCGGG 0: 1
1: 0
2: 0
3: 19
4: 181
1183293794_1183293801 14 Left 1183293794 22:37018594-37018616 CCTTGCGGGCCTCTCGGGTGCCT 0: 1
1: 0
2: 0
3: 8
4: 101
Right 1183293801 22:37018631-37018653 CGCGTCCAGCACCCGCAGGCCGG 0: 1
1: 0
2: 3
3: 7
4: 111
1183293794_1183293797 -10 Left 1183293794 22:37018594-37018616 CCTTGCGGGCCTCTCGGGTGCCT 0: 1
1: 0
2: 0
3: 8
4: 101
Right 1183293797 22:37018607-37018629 TCGGGTGCCTGGTGAGTACCAGG 0: 1
1: 0
2: 0
3: 7
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183293794 Original CRISPR AGGCACCCGAGAGGCCCGCA AGG (reversed) Exonic
900360635 1:2287189-2287211 AGGCGCCCTGGAGCCCCGCACGG - Intronic
900487728 1:2931368-2931390 GGGAAGCAGAGAGGCCCGCAGGG + Intergenic
902554851 1:17240857-17240879 AGACACTGGAGAGGTCCGCAGGG - Intronic
903218320 1:21855123-21855145 AGGCAGCCAAGAGGACGGCAGGG + Intronic
911042667 1:93603422-93603444 AGGCACTCTACAGGCCAGCAGGG + Intronic
915903100 1:159860461-159860483 TGGCTCCAGAGAGGCCAGCAAGG + Intronic
923751328 1:236748940-236748962 AGGCACCTCAGAGACCTGCAGGG + Intronic
1071514541 10:86288578-86288600 ACGCAACCGAGAGGCAAGCACGG - Intronic
1074412012 10:113236473-113236495 AGGCACCGCAGAGGACCCCAGGG - Intergenic
1076556014 10:131321989-131322011 AGGCACCCGACAGGCAGGGAAGG - Intergenic
1076809311 10:132878480-132878502 AGGGCCGCGAGGGGCCCGCAGGG - Intronic
1076865752 10:133165460-133165482 AGGCACCCCAGGGCCCCGCAGGG + Intronic
1077674055 11:4181959-4181981 GGGCAGACGAGAGGCCCTCAGGG + Intergenic
1081380619 11:42410114-42410136 AGGCACCTGAGAGGACCAAAGGG + Intergenic
1084476802 11:69393996-69394018 AGGCACCCTTGAGGCCCACTGGG - Intergenic
1089337360 11:117734400-117734422 GGGGACCCGAGGGGCCAGCAGGG - Intronic
1089871103 11:121673213-121673235 AGGCACCCGAGAAGGCCTCAGGG - Intergenic
1101897687 12:108768659-108768681 AGGCTCCAGAGCGCCCCGCAGGG - Intergenic
1102001490 12:109560594-109560616 AGGCTCCTGAAAGGCCTGCATGG - Intronic
1103555858 12:121766087-121766109 AGGCCCCCAGGAGGCCCGTAGGG - Intronic
1108493945 13:51006265-51006287 AGCCACTCCAGAGGCCCACAAGG - Intergenic
1108945645 13:56019663-56019685 AGGCACCAGAGAGGTCCCCATGG - Intergenic
1125588100 15:40836219-40836241 AGCCTCCAGAGAGGCCTGCATGG - Intergenic
1127784398 15:62343163-62343185 TGGCACCCGACCGGCCAGCACGG + Intergenic
1131272395 15:90955197-90955219 CGGGACCGGAGAGGCCCTCAAGG + Intronic
1134232456 16:12439301-12439323 AGTCACCAGAGAGGCCAGCGGGG + Intronic
1134242381 16:12515546-12515568 AGGAAGCAGAGAGGCCAGCAAGG - Intronic
1136737056 16:32475059-32475081 AGGCACCCTGGAGGCCACCAGGG + Intergenic
1137446409 16:48535152-48535174 AGGGACCTGAGAGCCCAGCAGGG - Intergenic
1138549663 16:57740528-57740550 AGGCACCCGGAAGGCCAGCGTGG - Intronic
1140113565 16:72023209-72023231 GGGCACCCTGGAGGCCCGCAGGG - Exonic
1140243450 16:73226197-73226219 AGGCACCTGGGAGGCCCTGAGGG - Intergenic
1141438243 16:84013130-84013152 AGGGACCCAGGAGGCCAGCAAGG + Intronic
1141834839 16:86531922-86531944 TGGCACTCGAGAGGCCTGCGTGG - Exonic
1142202951 16:88769868-88769890 AGGGAACAGAGAGGCCGGCATGG + Intronic
1203016015 16_KI270728v1_random:354518-354540 AGGCACCCTGGAGGCCACCAGGG - Intergenic
1203034350 16_KI270728v1_random:627676-627698 AGGCACCCTGGAGGCCACCAGGG - Intergenic
1142608661 17:1096196-1096218 AAGCACCCCAGAGGCCAGGACGG + Intronic
1142740159 17:1927248-1927270 AGGCTCCCCAGAGGCCACCATGG - Intergenic
1143163430 17:4885820-4885842 AGGCTCCTGAGAGGCCAGGATGG + Intronic
1147325460 17:39667636-39667658 GGGAACCCGCGGGGCCCGCAGGG + Intergenic
1147386862 17:40088144-40088166 CGGGAGCCGTGAGGCCCGCAAGG - Intronic
1152351180 17:79784775-79784797 AGCCCCCGGAGAAGCCCGCAAGG + Exonic
1152599158 17:81252812-81252834 AGGCAGCAGGGAGGCCGGCAGGG - Intronic
1152896561 17:82914627-82914649 AGGCAGCCAAGGGGCCCCCAGGG - Intronic
1152921137 17:83067173-83067195 AGGGACCCGAGAGACCCGCTGGG + Intergenic
1158602259 18:58864604-58864626 AAGCACCCCAGAGCCCCTCAGGG - Intronic
1160773613 19:844495-844517 AGGCAGGGGAGAGGCGCGCAGGG - Intronic
1161588445 19:5117974-5117996 AGGCGCCCCAGAAGCCAGCATGG + Intronic
925235792 2:2276238-2276260 AGGCACCACACAGGCACGCAAGG - Intronic
927152425 2:20203712-20203734 AGGAATACGAGATGCCCGCAGGG + Intronic
932780137 2:74554375-74554397 GGGCACCGGAGAGACCCACACGG - Exonic
934308411 2:91843777-91843799 AGGCACCCTGGAGGCCACCAGGG - Intergenic
934689463 2:96347200-96347222 AGCCACTGCAGAGGCCCGCAGGG + Intronic
934954919 2:98609093-98609115 AGGCCCCCCAGACGCCGGCAGGG - Intronic
935600225 2:104914965-104914987 AGGCACCTGTGAGGCCTTCAGGG - Intergenic
946774407 2:223122909-223122931 AGGCACCAGAGAGGCTGGCCAGG - Intronic
947129303 2:226904982-226905004 AGGCACATGAGAGGCACTCAAGG - Intronic
948487394 2:238289383-238289405 AGGCACCTCAGAGGCCCGGGTGG - Intronic
1175225126 20:57440143-57440165 AGGCAGCCAGGAGGCCCACAGGG - Intergenic
1179647101 21:42782738-42782760 GGTCACCAGAGAGGCCCACAGGG + Intergenic
1180187363 21:46146188-46146210 AGGGACCCCAGCGCCCCGCAAGG + Intronic
1180535496 22:16390857-16390879 AGGCACCCTGGAGGCCACCAGGG - Intergenic
1180676216 22:17588192-17588214 AGGCTCACTAGAGGCCCTCATGG + Intronic
1180969690 22:19808770-19808792 AGGCACCAGGGCGGCCTGCAAGG + Intronic
1181519748 22:23438428-23438450 ACGCACCCGTGAGGCCGTCAAGG + Intergenic
1183293794 22:37018594-37018616 AGGCACCCGAGAGGCCCGCAAGG - Exonic
1184215132 22:43061687-43061709 AGGGACTGGAGAGGCCAGCAAGG - Intronic
1184235383 22:43180426-43180448 AGTCCCCGGAGAGGCCAGCAGGG + Intronic
1185102804 22:48850584-48850606 AGGCACCTGAGAGGCCCACCTGG + Intronic
1185337114 22:50275642-50275664 AGGTACCTGAGAGCCCCTCAGGG - Exonic
950520299 3:13494184-13494206 ATGCAGCCGAGAGCCCAGCATGG - Intronic
951434284 3:22643569-22643591 AGGCACCGGAGAGGATCTCATGG + Intergenic
961458401 3:127035480-127035502 CGGCACCCCAGAGGCTCTCAGGG - Exonic
962958217 3:140285974-140285996 AAACACCCTAGAGGCCAGCAGGG - Intronic
969605965 4:8202461-8202483 AGGCACCCAAGAGACCCTCCGGG - Intronic
969669035 4:8579692-8579714 CGGCACGAGAGAGGCCCACAGGG + Intronic
985490274 5:174960-174982 GGGCACCCAAGAGGCCCACCCGG + Intronic
985666495 5:1183959-1183981 AGGCTCCCGATAGGCTGGCAAGG + Intergenic
986524394 5:8657510-8657532 AGGCACCCGAGAGACCAGGAAGG + Intergenic
987362977 5:17123281-17123303 AGGCAGCAGAGAGGCTCCCAAGG + Intronic
989171047 5:38470381-38470403 AGGCCCCCGAGATGCTTGCATGG - Intergenic
999731482 5:154479044-154479066 AGGCACCCGGGAGGCCGGAGTGG - Intergenic
1001815126 5:174662152-174662174 AGGCAACAGAGATGCCTGCAAGG + Intergenic
1002006522 5:176238751-176238773 CGGGGCCCGAGAGGCCCGGAAGG - Intronic
1002219856 5:177671885-177671907 CGGGGCCCGAGAGGCCCGGAAGG + Intergenic
1002618319 5:180469018-180469040 AGCCACCAGAGATGCCCACACGG + Intergenic
1002974673 6:2062229-2062251 GGGCACCTGAGAGTCCTGCATGG + Intronic
1006513448 6:34533624-34533646 AGGCACCCGTGCGGCCTTCACGG - Exonic
1006976521 6:38107459-38107481 AGGCACCTGACAAGCCCACATGG - Intronic
1010816503 6:80364322-80364344 TGGCAGCCAAGAGGCCTGCAGGG + Intergenic
1017143943 6:151216892-151216914 AGGCAGCCAAGAGGTCCCCAGGG + Intergenic
1019136397 6:169911387-169911409 GGGCTCCCAAGAGGCCGGCAAGG + Intergenic
1019591513 7:1837844-1837866 ACGCACCCGTGAGGCCATCAAGG - Intronic
1022470492 7:30679123-30679145 AGGCACAGGAGAGGCCCTCTAGG - Intronic
1029996360 7:105012426-105012448 AGGCCTCCCAGAGGCCCTCAAGG + Intergenic
1032316728 7:130844987-130845009 AGGCAGCCCAGCAGCCCGCATGG - Intergenic
1039231485 8:35453694-35453716 AAGCAGCCAAGAGGCCTGCAAGG - Intronic
1039311566 8:36322370-36322392 AGGCACTGGAGAGGCCCTGAGGG - Intergenic
1041399322 8:57425318-57425340 AGTCAGCCGTGAGGCCCACAAGG - Intergenic
1048428236 8:134342524-134342546 AGGCACAGGAGAGGCCCTCTGGG - Intergenic
1056020517 9:82433588-82433610 AGGCACTGGAGAGGCCCCCGGGG - Intergenic
1056576704 9:87860059-87860081 AGGCACTGGAGAGGCCCCCGGGG - Intergenic
1057306014 9:93912401-93912423 AGCCACCTCAGAGGCCAGCACGG + Intergenic
1057409098 9:94800850-94800872 AGGCACCCGTGAGGCACACAGGG - Exonic
1061059558 9:128243654-128243676 AGGCTCCCTAGATGCCCCCATGG + Intronic
1061778908 9:132984442-132984464 AGGGACCCCAGAGGCCTTCAAGG + Intronic
1062107930 9:134765830-134765852 AGGCGCCAGAGGGGCCAGCACGG - Intronic
1185467156 X:361887-361909 AGGCACCTGAGAGCCCAGCCAGG + Intronic
1200111630 X:153743705-153743727 AGGCACCCTGGAGGCCACCAGGG - Exonic