ID: 1183293796

View in Genome Browser
Species Human (GRCh38)
Location 22:37018603-37018625
Sequence GTACTCACCAGGCACCCGAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 63}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183293796_1183293800 1 Left 1183293796 22:37018603-37018625 CCTCTCGGGTGCCTGGTGAGTAC 0: 1
1: 0
2: 0
3: 0
4: 63
Right 1183293800 22:37018627-37018649 AGGACGCGTCCAGCACCCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 51
1183293796_1183293802 6 Left 1183293796 22:37018603-37018625 CCTCTCGGGTGCCTGGTGAGTAC 0: 1
1: 0
2: 0
3: 0
4: 63
Right 1183293802 22:37018632-37018654 GCGTCCAGCACCCGCAGGCCGGG 0: 1
1: 0
2: 0
3: 19
4: 181
1183293796_1183293801 5 Left 1183293796 22:37018603-37018625 CCTCTCGGGTGCCTGGTGAGTAC 0: 1
1: 0
2: 0
3: 0
4: 63
Right 1183293801 22:37018631-37018653 CGCGTCCAGCACCCGCAGGCCGG 0: 1
1: 0
2: 3
3: 7
4: 111
1183293796_1183293808 29 Left 1183293796 22:37018603-37018625 CCTCTCGGGTGCCTGGTGAGTAC 0: 1
1: 0
2: 0
3: 0
4: 63
Right 1183293808 22:37018655-37018677 CCCCAGCTTGCCAGTCCTGATGG 0: 1
1: 1
2: 1
3: 28
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183293796 Original CRISPR GTACTCACCAGGCACCCGAG AGG (reversed) Exonic
907682384 1:56577189-56577211 GTACTCCCCTGGGACCAGAGAGG + Intronic
918480724 1:184974269-184974291 GTGCTCCCCAGGCCCCCGGGCGG + Intronic
1062938431 10:1404642-1404664 AGACTCGCCAGGCACCAGAGAGG - Intronic
1072117978 10:92382014-92382036 GTGCTCAACAGGCACCTAAGTGG + Intergenic
1072955655 10:99885679-99885701 CTACTCACCAGGCCCAGGAGTGG + Exonic
1076684610 10:132192393-132192415 GTACCAACCAGGGACCTGAGTGG + Intronic
1077406261 11:2383787-2383809 GTCCTGCCCAGGCACCCCAGTGG - Intronic
1081656845 11:44863008-44863030 GCACTCAACAGGCACCTCAGAGG + Intronic
1091934362 12:4423465-4423487 GCATTTACCAGGCACCCAAGTGG - Intergenic
1098463262 12:70757988-70758010 GTAGTGAGCAGGCACCCCAGTGG - Intronic
1103401778 12:120648122-120648144 GTGCTCACTAGGGACCCCAGAGG - Intronic
1104810884 12:131619806-131619828 GGACTCACCAGACCCCAGAGTGG + Intergenic
1108517812 13:51219609-51219631 CTTCCCACCAGGCACCTGAGAGG - Intergenic
1110178095 13:72582240-72582262 GTACAGACCAGGAAGCCGAGGGG - Intergenic
1113306045 13:109079788-109079810 GTGCTCACAAGACACCCCAGGGG - Intronic
1113436753 13:110298654-110298676 TTCCTCACCAGGAAGCCGAGTGG + Intronic
1115708918 14:36028424-36028446 GTTCTCACCAGACACCGGATTGG + Intergenic
1118324848 14:64773845-64773867 GTCCTCAGCAGCCACCCCAGAGG - Intronic
1122017913 14:98812270-98812292 GTACTGATCAGGCACCCTATAGG + Intergenic
1123049203 14:105532505-105532527 GTACTCACCAGGAATCAGTGAGG - Intergenic
1139530482 16:67540177-67540199 GTACTCGCGATGCCCCCGAGTGG - Exonic
1147797231 17:43053252-43053274 GTTCTCCCCAGGCAGCCAAGTGG + Intronic
1152813655 17:82394419-82394441 GGACTCACCACCCGCCCGAGAGG - Exonic
1159720119 18:71879306-71879328 GCACTCACCAGGCACCAAATCGG - Intergenic
1164935011 19:32203213-32203235 GTACGCACCAGGCATCCATGGGG - Intergenic
1167259499 19:48450512-48450534 GGACTCACCGGTCACCCGGGGGG - Exonic
1168059161 19:53881954-53881976 GGACACACGAGGCACCCTAGTGG + Intronic
929568260 2:43003875-43003897 GTACTCACCAGGAACCAAATTGG + Intergenic
930053191 2:47232821-47232843 TTACTCATCAGACACCCCAGAGG + Intergenic
937878592 2:126848063-126848085 GTCCTCACCAGACACCCAATTGG - Intergenic
938092316 2:128441708-128441730 GGACTCACCAGGCTTCCGACTGG - Intergenic
946419680 2:219557815-219557837 GTACTCACCAGCCACCTGGACGG + Exonic
947456447 2:230258458-230258480 ATACTCACCAGCCACCCTTGTGG + Intronic
1171256486 20:23692476-23692498 GTAGTCACCATGCAGCCTAGGGG - Intergenic
1172999213 20:39093397-39093419 GTCCTCCCCAGACACCCAAGAGG - Intergenic
1174419456 20:50390190-50390212 GTATGCGCCAGGCACCCGATGGG - Intergenic
1175241874 20:57555783-57555805 CTACTCACTGGGCACCCGACTGG - Intergenic
1175988600 20:62776629-62776651 GAGCTCTCCAGGCCCCCGAGCGG - Intergenic
1176114914 20:63428023-63428045 GTTACCACCAGGCACTCGAGAGG + Intronic
1180014133 21:45072008-45072030 GATCTCAGCAGGCACCCGAATGG + Intergenic
1183293796 22:37018603-37018625 GTACTCACCAGGCACCCGAGAGG - Exonic
954304019 3:49716163-49716185 GTCCTCACCAGGCAGCCGTAGGG - Exonic
955354304 3:58217689-58217711 GTCCTCACCATGCACCCTTGTGG - Intergenic
967201249 3:187074319-187074341 GAACTCACCAAGCATCCCAGAGG - Exonic
971024101 4:22571177-22571199 GTGGTCCCCAGGCCCCCGAGTGG + Intergenic
973311084 4:48710610-48710632 GTACTTTACAGGCACTCGAGTGG + Exonic
981616263 4:146647861-146647883 GTGCGCACCAGGAACCAGAGGGG - Intergenic
994884474 5:105541752-105541774 GTTCTCACCTGGCACCCTGGAGG + Intergenic
1004511855 6:16289760-16289782 GTACAGACCAGACACCTGAGGGG + Intronic
1011099823 6:83708837-83708859 GTACTCACCCCGCCCCTGAGCGG + Intronic
1012894942 6:104937377-104937399 GTACTCAGCAGACAGCCGGGAGG - Intergenic
1019728749 7:2617878-2617900 GTTCTCACCAGGCCCCACAGGGG + Intergenic
1024030347 7:45455311-45455333 GTGCTCAGGAGGCCCCCGAGCGG - Intergenic
1026767101 7:73167019-73167041 CCACTCACCAGGCACCAGGGTGG - Intergenic
1027043570 7:74976730-74976752 CCACTCACCAGGCACCAGGGTGG - Intronic
1027080077 7:75225629-75225651 CCACTCACCAGGCACCAGGGTGG + Intergenic
1029389298 7:100264234-100264256 CCACTCACCAGGCACCAGGGTGG + Intronic
1035301835 7:157902346-157902368 GTACTCTCCAGGCCACCGCGGGG - Intronic
1035301862 7:157902448-157902470 GTACTCTCCAGGCCACCGCGGGG - Intronic
1051840550 9:21392853-21392875 GTACTCCCAAGTCACCCTAGTGG + Intergenic
1056565828 9:87771591-87771613 GTACTCGCCGGGCACCGGGGTGG - Intergenic
1060407081 9:123378145-123378167 GTACTCAGCAGACAACCCAGAGG - Exonic
1061816567 9:133200819-133200841 GCACTCACCAGGCAAGCGGGTGG + Intergenic
1203773512 EBV:60930-60952 GGACTCCCCAGGCATCGGAGGGG + Intergenic