ID: 1183293798

View in Genome Browser
Species Human (GRCh38)
Location 22:37018614-37018636
Sequence GACGCGTCCTGGTACTCACC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 33}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183293798_1183293802 -5 Left 1183293798 22:37018614-37018636 CCTGGTGAGTACCAGGACGCGTC 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1183293802 22:37018632-37018654 GCGTCCAGCACCCGCAGGCCGGG 0: 1
1: 0
2: 0
3: 19
4: 181
1183293798_1183293801 -6 Left 1183293798 22:37018614-37018636 CCTGGTGAGTACCAGGACGCGTC 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1183293801 22:37018631-37018653 CGCGTCCAGCACCCGCAGGCCGG 0: 1
1: 0
2: 3
3: 7
4: 111
1183293798_1183293808 18 Left 1183293798 22:37018614-37018636 CCTGGTGAGTACCAGGACGCGTC 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1183293808 22:37018655-37018677 CCCCAGCTTGCCAGTCCTGATGG 0: 1
1: 1
2: 1
3: 28
4: 184
1183293798_1183293800 -10 Left 1183293798 22:37018614-37018636 CCTGGTGAGTACCAGGACGCGTC 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1183293800 22:37018627-37018649 AGGACGCGTCCAGCACCCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183293798 Original CRISPR GACGCGTCCTGGTACTCACC AGG (reversed) Exonic
901399677 1:9007291-9007313 GAGGCGTGCAGGTACTCACTGGG + Exonic
905414697 1:37795745-37795767 GTCCTGTCCTGGTACCCACCTGG + Exonic
920340593 1:205272936-205272958 GACCTCTCCTGGTACTCAGCAGG - Exonic
920600759 1:207321737-207321759 GGCGCGTCCTTGTTCTAACCCGG + Exonic
1081998313 11:47378290-47378312 GAGGAGTCCCGGTACTCACAGGG + Exonic
1085456547 11:76668762-76668784 GACCCTTCCTTGTCCTCACCTGG - Intronic
1123118444 14:105905307-105905329 AACCTGTCCTGGAACTCACCTGG - Intergenic
1123404144 15:20010401-20010423 GGCTCCTCCTGGTACTCACTAGG - Intergenic
1123513482 15:21017047-21017069 GGCTCCTCCTGGTACTCACTAGG - Intergenic
1123716698 15:23039163-23039185 GACGCGTCCTGATCGTCACGGGG - Intronic
1126351055 15:47745198-47745220 CAGGCTTCCTGGTACTCACCTGG + Intronic
1126572257 15:50164653-50164675 GACAAGTCCTGGTACTGTCCTGG - Intronic
1127700580 15:61496331-61496353 TATGCCTCCTGGGACTCACCTGG - Intergenic
1131646281 15:94348530-94348552 AACGTCTCCTGGTTCTCACCTGG - Intronic
1142138269 16:88461279-88461301 CAAGCATCCTGGTCCTCACCAGG - Intronic
1142644450 17:1302898-1302920 GCCGCGTCCTGGGGCTCAGCAGG + Intergenic
1144831274 17:18132563-18132585 GATGCCTGCTGGCACTCACCTGG - Exonic
1162561597 19:11420813-11420835 GACTCGTCCTGACACCCACCAGG - Exonic
1163398120 19:17075871-17075893 GAGGCTGCCTGGTACTCACCTGG - Exonic
1167150088 19:47703376-47703398 AACGGGGCCTGGTACTCAGCAGG - Intergenic
928079859 2:28301289-28301311 GACACTTCCTGGCACTGACCAGG + Intronic
933726314 2:85429609-85429631 GAGGAGTCCCAGTACTCACCGGG - Intronic
944335953 2:198534917-198534939 GTCTCATCCTGGTACTCAACGGG + Intronic
948829199 2:240589533-240589555 AAGGCCTCCTGGTACTCAGCAGG - Intronic
1183058860 22:35323174-35323196 GCCCTGTCCTGGCACTCACCTGG - Exonic
1183293798 22:37018614-37018636 GACGCGTCCTGGTACTCACCAGG - Exonic
973271899 4:48270063-48270085 GACGCTCCCTGAAACTCACCGGG - Intergenic
980801927 4:137762843-137762865 GATGAGTCCTGGTACTCAGCAGG - Intergenic
1016715118 6:147216885-147216907 GACGAGTCCTAGAACTCACATGG + Intronic
1020189481 7:5984472-5984494 GACGTTTTCTGGTTCTCACCTGG + Intronic
1020293437 7:6740183-6740205 GACGTTTTCTGGTTCTCACCTGG - Intergenic
1023034489 7:36118662-36118684 GGAGCCTCCTGGTACCCACCTGG + Intergenic
1056792406 9:89634270-89634292 GACACGTCCTTGTGCTCTCCTGG + Intergenic
1060297255 9:122351137-122351159 GCCGCGTCATTGTCCTCACCTGG + Intergenic
1060749539 9:126159863-126159885 CACATGTTCTGGTACTCACCAGG + Intergenic
1061780549 9:132993747-132993769 GACCCGTTCTGGTGCTCCCCAGG + Intergenic
1189868878 X:45361067-45361089 GATGAGTCCTAGTACTGACCTGG - Intergenic