ID: 1183293800

View in Genome Browser
Species Human (GRCh38)
Location 22:37018627-37018649
Sequence AGGACGCGTCCAGCACCCGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 51}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183293798_1183293800 -10 Left 1183293798 22:37018614-37018636 CCTGGTGAGTACCAGGACGCGTC 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1183293800 22:37018627-37018649 AGGACGCGTCCAGCACCCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 51
1183293794_1183293800 10 Left 1183293794 22:37018594-37018616 CCTTGCGGGCCTCTCGGGTGCCT 0: 1
1: 0
2: 0
3: 8
4: 101
Right 1183293800 22:37018627-37018649 AGGACGCGTCCAGCACCCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 51
1183293796_1183293800 1 Left 1183293796 22:37018603-37018625 CCTCTCGGGTGCCTGGTGAGTAC 0: 1
1: 0
2: 0
3: 0
4: 63
Right 1183293800 22:37018627-37018649 AGGACGCGTCCAGCACCCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183293800 Original CRISPR AGGACGCGTCCAGCACCCGC AGG Exonic
900739059 1:4319440-4319462 AGGATGCATACTGCACCCGCCGG + Intergenic
905345032 1:37305623-37305645 GGGAAGCCTCCAGCACCCACTGG - Intergenic
1069824112 10:71244867-71244889 AGACCGCCTCCAGCTCCCGCTGG + Intronic
1071267244 10:83975179-83975201 AGGATGAGTCCAGGACCCACTGG + Intergenic
1073349377 10:102809024-102809046 AGGACGCCTCCAGCACCTTGGGG - Intronic
1077015555 11:397596-397618 AGGCCGCTCCCAGCACCTGCAGG - Exonic
1083777982 11:64903489-64903511 AGGACCCGGCCAGCAGCTGCGGG + Intronic
1092821479 12:12357290-12357312 CTGACGCGTCCAGCCCACGCAGG - Exonic
1101083286 12:101209957-101209979 AGGACGCCTCCAGTCCCCGCGGG - Exonic
1103729043 12:123013856-123013878 AAGACTCCTCCACCACCCGCAGG + Exonic
1104688570 12:130806988-130807010 AGGCCGCATCCAGCGCCAGCTGG - Exonic
1104831563 12:131755866-131755888 AGGACACCCCCAGCACCAGCTGG - Intronic
1113788187 13:113013983-113014005 AGCACGGGGCCAGCACCAGCTGG - Intronic
1121112388 14:91321188-91321210 GGGACGCGTCCCGCAGCCCCTGG + Exonic
1121451996 14:94014605-94014627 AAGACGCTTCCAGCAACCTCAGG + Intergenic
1127856994 15:62961242-62961264 CTGGCCCGTCCAGCACCCGCTGG - Intergenic
1132065510 15:98727742-98727764 CGGGTGGGTCCAGCACCCGCTGG + Intronic
1132600946 16:772719-772741 AGGACTCATCCAGCACAGGCGGG + Exonic
1132904303 16:2274264-2274286 AGCACGCTGCCAGCACCAGCAGG - Intergenic
1134174933 16:11998030-11998052 AGGATGCGCCCAGCACACGGTGG + Intronic
1142982194 17:3678782-3678804 AGGAGGTGTCCAGCCCCCACTGG + Intronic
1161428543 19:4217572-4217594 AGGCCGCCTCCAGCTCCCGCAGG - Exonic
1164767720 19:30784520-30784542 TGGATGCGTCCAGAACCCGCTGG - Intergenic
1166366341 19:42280394-42280416 GGGCCGCGCCCAGCCCCCGCTGG + Intronic
942059607 2:172215836-172215858 AGGTCTCGTCCAGTACCTGCTGG - Intergenic
948625405 2:239265214-239265236 AGGATGGGTCCAGCACACTCAGG + Intronic
948765789 2:240217984-240218006 AGGCCCCTTCCAGGACCCGCGGG + Intergenic
1168790630 20:573528-573550 GGGATGCGTCCAGCCCCCTCTGG - Intergenic
1176553207 21:8239022-8239044 AGGATACATCCAGCACCCGGGGG - Intergenic
1176572129 21:8422046-8422068 AGGATACATCCAGCACCCGGGGG - Intergenic
1176580038 21:8466629-8466651 AGGATACATCCAGCACCCGGGGG - Intergenic
1179173275 21:38989560-38989582 AGGACGCGTCCAGCTCCTTGAGG - Intergenic
1179912386 21:44456986-44457008 AAGACAGGTCCAGCAGCCGCAGG - Exonic
1180137467 21:45871003-45871025 AGGGAGAGCCCAGCACCCGCTGG + Intronic
1183293800 22:37018627-37018649 AGGACGCGTCCAGCACCCGCAGG + Exonic
1203258205 22_KI270733v1_random:156064-156086 AGGATACATCCAGCACCCGGGGG - Intergenic
975796873 4:78015391-78015413 AGGACTCCTCCAGCAGCTGCTGG + Intergenic
984704066 4:182835097-182835119 AAGGCGCGTGCAGAACCCGCTGG - Intergenic
985995783 5:3596177-3596199 CGGCCGCGGCCAGCACCCCCGGG - Exonic
998256360 5:140591680-140591702 GGGACACGTCCAGCACCGACAGG + Intronic
1002805230 6:567267-567289 AGGACGCCTGCAGCACCAGGAGG - Intronic
1004507453 6:16258554-16258576 AGGCCCTCTCCAGCACCCGCTGG + Intronic
1007581159 6:42960941-42960963 AGGCTACGTCGAGCACCCGCTGG - Exonic
1013057663 6:106600124-106600146 AGGAAGCCTCCAGCACCATCTGG + Intronic
1018368810 6:163149249-163149271 GGGAAGCGGCCAGCGCCCGCGGG - Intronic
1018400605 6:163415526-163415548 AGGGGGCGTCCGGCACCGGCGGG - Intronic
1023883474 7:44334856-44334878 AGGGAGCGTCCAGCAACCGAGGG - Intergenic
1024865946 7:53905156-53905178 AGGATGAGTCCAGGACCCACTGG - Intergenic
1039996720 8:42541178-42541200 AGGAGGCGCCCGGCACTCGCAGG + Exonic
1060736351 9:126068871-126068893 AGGAAGCGGACAGCACCTGCAGG + Intergenic
1061680928 9:132242123-132242145 AGGACGCTCCCCGCACCCGGAGG + Exonic
1062729003 9:138097948-138097970 AGGGCCCGTGCAGCACCCTCTGG - Intronic
1203474399 Un_GL000220v1:138087-138109 AGGATACATCCAGCACCCGGGGG - Intergenic
1185457891 X:319682-319704 AGGCGGCGTCCAGGACCCCCAGG - Intergenic
1199556426 X:149114137-149114159 AGGCTGGGTCCAGCACCTGCTGG - Intergenic