ID: 1183293801

View in Genome Browser
Species Human (GRCh38)
Location 22:37018631-37018653
Sequence CGCGTCCAGCACCCGCAGGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 3, 3: 7, 4: 111}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183293794_1183293801 14 Left 1183293794 22:37018594-37018616 CCTTGCGGGCCTCTCGGGTGCCT 0: 1
1: 0
2: 0
3: 8
4: 101
Right 1183293801 22:37018631-37018653 CGCGTCCAGCACCCGCAGGCCGG 0: 1
1: 0
2: 3
3: 7
4: 111
1183293796_1183293801 5 Left 1183293796 22:37018603-37018625 CCTCTCGGGTGCCTGGTGAGTAC 0: 1
1: 0
2: 0
3: 0
4: 63
Right 1183293801 22:37018631-37018653 CGCGTCCAGCACCCGCAGGCCGG 0: 1
1: 0
2: 3
3: 7
4: 111
1183293798_1183293801 -6 Left 1183293798 22:37018614-37018636 CCTGGTGAGTACCAGGACGCGTC 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1183293801 22:37018631-37018653 CGCGTCCAGCACCCGCAGGCCGG 0: 1
1: 0
2: 3
3: 7
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183293801 Original CRISPR CGCGTCCAGCACCCGCAGGC CGG Exonic
900140820 1:1138945-1138967 GGGGTCCAGAACCCGCAGGCTGG - Intergenic
902401907 1:16162545-16162567 CGCATCCAGGCCCCGCGGGCAGG - Intergenic
904463146 1:30692425-30692447 CTGGTCCAGCCCCCGCAGCCAGG + Intergenic
906095784 1:43223070-43223092 CCTGGCCAGCACCCCCAGGCCGG - Intronic
906876156 1:49541517-49541539 CGAGCACAGCACCGGCAGGCCGG - Intronic
907452905 1:54558762-54558784 GGCTTCCAGGACCTGCAGGCTGG + Intronic
915367333 1:155323531-155323553 CGCCCCCAGCAGCCGCAGCCCGG - Intronic
919930129 1:202215687-202215709 CTTGTCCAGGACCCGCAGGTGGG + Intronic
924754728 1:246931279-246931301 CGCGTCCTGCGCCGGCAGTCGGG - Intronic
1063296577 10:4812719-4812741 AGCTTGCAGCACCGGCAGGCGGG + Intronic
1063380428 10:5582153-5582175 CCCGTCCAGCTCCTGCAGCCAGG + Intergenic
1065882945 10:30052635-30052657 AGCGTGCAGCACCCGCACTCTGG - Intronic
1067039249 10:42940245-42940267 TGCATCCATCACCCGCAGCCTGG - Intergenic
1070172738 10:73944786-73944808 CGAGCACAGCACCCGCGGGCCGG - Intergenic
1070620022 10:78002237-78002259 CTTGTCCAGCTCCCGGAGGCAGG + Exonic
1073970326 10:109040777-109040799 TGCATGCAGCACTCGCAGGCCGG + Intergenic
1075627526 10:123973307-123973329 CGCGTGCAGACTCCGCAGGCGGG + Intergenic
1077015553 11:397592-397614 CGCTCCCAGCACCTGCAGGTTGG - Exonic
1077081379 11:726080-726102 CGCCCCCCGCCCCCGCAGGCCGG + Exonic
1080388510 11:31824290-31824312 CGTGCCTAGCACCTGCAGGCTGG - Intronic
1083540738 11:63510097-63510119 GGTGTCCAGGAGCCGCAGGCAGG + Intronic
1084089507 11:66870735-66870757 CGCCTCCAGCTGCCCCAGGCGGG + Intronic
1085394525 11:76200604-76200626 CTTGTCCAGCACCCGCCAGCAGG + Intronic
1089391456 11:118104712-118104734 CGAGTCCAGCACCTGCAGTGTGG - Exonic
1096102937 12:48980358-48980380 CGCGGCCAGCACCCTCATGAAGG - Intronic
1101303299 12:103503425-103503447 CGTGTGCAGAACACGCAGGCTGG - Intergenic
1102678562 12:114674587-114674609 CTCGTCCAGCACTCGCGGCCTGG - Exonic
1106735695 13:32586392-32586414 CGCGGACAGCACCCGGGGGCAGG - Intergenic
1122131262 14:99605353-99605375 CGCGTCTACCGCCAGCAGGCGGG + Intergenic
1122778671 14:104134499-104134521 CTTGACCAGCACCAGCAGGCTGG + Intergenic
1132591493 16:728157-728179 CGCGCCCAGCACCGCCAGCCCGG - Exonic
1132751044 16:1457879-1457901 GGGGGCCAGCACCCCCAGGCTGG + Intronic
1132970069 16:2682841-2682863 CGTGTGCAGGAGCCGCAGGCCGG - Intronic
1133234525 16:4381740-4381762 AGCTGCCAGCAGCCGCAGGCGGG - Exonic
1136396071 16:29993252-29993274 CCCGTCCCGCACCCCCAGACTGG - Exonic
1138490259 16:57372420-57372442 CGCCTCCAGCCCCCGCAGGCAGG - Intergenic
1139954192 16:70685571-70685593 GGCGCCCAGCAGACGCAGGCAGG + Intronic
1142008654 16:87702396-87702418 CCCGTCCTGCACCCCCAGCCTGG + Intronic
1142181370 16:88672455-88672477 CGGGACCAGGACCCGCTGGCTGG + Intergenic
1143109319 17:4544635-4544657 CAGGTCCAGCACCTGCAGCCAGG + Exonic
1148684778 17:49495307-49495329 CGCGGCCAGCTCCGGCGGGCAGG + Exonic
1150821280 17:68436282-68436304 CGCCTCCAGCCCCCGACGGCAGG + Intronic
1151585045 17:75003728-75003750 CTCGTCCACCTCCCGCAGGATGG - Exonic
1152286517 17:79416091-79416113 TCCTTCCAGCACCCCCAGGCAGG + Intronic
1152287795 17:79422585-79422607 AGGGTCCAGCAGCCTCAGGCTGG + Intronic
1152401796 17:80070910-80070932 AGTGTCCAGCTCCCACAGGCAGG - Intronic
1152708938 17:81860592-81860614 CGCGGCCAGCGCGCGCGGGCGGG - Exonic
1153227083 18:2907250-2907272 CTAGTCCAGCACACGGAGGCCGG + Intronic
1160018378 18:75161752-75161774 CGTGTCCAGCATCAGCAGGAAGG + Intergenic
1160190817 18:76712817-76712839 TGCCTCCTGCACCCACAGGCGGG - Intergenic
1160904567 19:1446220-1446242 CGCGTCCCGCACCCCCACCCTGG + Intergenic
1161234217 19:3190014-3190036 GGCCTCGAGCTCCCGCAGGCGGG - Intronic
1161237218 19:3204122-3204144 CGTCTCCAGCTCCCGCAGGAAGG - Exonic
1161428540 19:4217568-4217590 CGCCTCCAGCTCCCGCAGGCGGG - Exonic
1165129489 19:33622835-33622857 CGCCTCCAGCACTCACAGGCCGG - Intronic
1165846594 19:38821680-38821702 CGAGTGCAGCACCAGCGGGCCGG - Intronic
926095787 2:10080101-10080123 CGCCACCGGCACCCGCCGGCGGG + Exonic
926149186 2:10415294-10415316 CCCCTCCAGCTCCCGCAGTCAGG - Intronic
926217235 2:10913040-10913062 GGCGTCCAGCACCTGCAGCTCGG - Exonic
931719429 2:65056540-65056562 CGACACCAGCACCCGCACGCGGG - Intronic
937325700 2:120988658-120988680 CGCGTCCAGCAGCGCCAGCCTGG - Exonic
938160463 2:128980630-128980652 CGCCTCCAGCAGCCACATGCAGG - Intergenic
942429060 2:175890319-175890341 AGCATCCAGCACCAGCAGGTTGG - Intergenic
946235656 2:218323167-218323189 CACGTCCAGAGCCGGCAGGCAGG + Intronic
947518721 2:230828419-230828441 CGCGTCCGGCACCCGGAGCTAGG + Intergenic
948242172 2:236446894-236446916 CACGCCCAGCAGCCGCAGTCAGG - Intronic
948805635 2:240452606-240452628 CAGGAGCAGCACCCGCAGGCGGG + Intronic
949048162 2:241881753-241881775 CCCGTCCAGCCCCCGCACACAGG - Intergenic
1169867232 20:10215241-10215263 AGTGTCCAGCAGCCACAGGCTGG - Intergenic
1172742372 20:37179170-37179192 CGCTTCCAGCAGCCGCGGCCGGG - Exonic
1176055228 20:63141719-63141741 AGAGTCCAGCATCTGCAGGCTGG - Intergenic
1178948256 21:36966207-36966229 CGCGTCCAGCACCGCCCGGCTGG + Intronic
1179225083 21:39445813-39445835 CGCGCCCAGCCCCCGCAGGCCGG - Intergenic
1179574107 21:42296262-42296284 CACGTCCAGCTCCCGCAGGATGG - Exonic
1181519324 22:23436330-23436352 CGCGTCCAGCACCTGCAGCGGGG - Intergenic
1183293801 22:37018631-37018653 CGCGTCCAGCACCCGCAGGCCGG + Exonic
1183951041 22:41353366-41353388 CCTGTCCATCACCCCCAGGCGGG + Intronic
1184130486 22:42514179-42514201 CCTCTCCAGCACCCGCAAGCTGG + Exonic
1184140662 22:42576001-42576023 CCTCTCCAGCACCCGCAAGCTGG + Intergenic
1185060305 22:48603117-48603139 CACGTCCAGGACCTGCTGGCTGG + Intronic
953778203 3:45841717-45841739 TGGCTCCAGCCCCCGCAGGCAGG + Intronic
961624253 3:128248941-128248963 CTCATCCAGCACCAGCAGGCTGG + Intronic
964993498 3:162844790-162844812 CGAGTGCAGCACTGGCAGGCTGG + Intergenic
968729101 4:2261460-2261482 CGCGTACAGCGCCCGCCGCCGGG - Intronic
968913515 4:3487278-3487300 TGGGCCCAGCCCCCGCAGGCTGG + Intronic
969227493 4:5808262-5808284 CACGCCCAGCAGCAGCAGGCAGG + Exonic
976178908 4:82380977-82380999 CCAGTCCAGGAGCCGCAGGCTGG - Intergenic
977906493 4:102483311-102483333 CGAGTGCAGCACCGGTAGGCTGG - Intergenic
980943350 4:139295650-139295672 CGCCTCCTGCACCCGTGGGCTGG + Intronic
981938957 4:150261389-150261411 GGCCTCCAGCACCATCAGGCGGG + Intergenic
982198068 4:152936070-152936092 TGCTTCCCGCACCCGAAGGCTGG - Intergenic
985747678 5:1656361-1656383 AGCGGCCCGCACCTGCAGGCCGG - Intergenic
985797469 5:1973659-1973681 CCGGTCCAGCTCCCGCGGGCTGG + Intergenic
985923574 5:2998498-2998520 TGCCTCCAGCACACACAGGCAGG + Intergenic
1001530051 5:172455035-172455057 CGGGCGCAGCACCGGCAGGCAGG - Intergenic
1002616463 5:180459354-180459376 CGAGCACAGCACCAGCAGGCCGG - Intergenic
1004507456 6:16258558-16258580 CCTCTCCAGCACCCGCTGGCTGG + Intronic
1005987872 6:30885296-30885318 CGCTTCCAGCAGCCAGAGGCAGG + Intronic
1006256716 6:32838183-32838205 CGCGTCCACCAGCAGCAGGGAGG + Exonic
1007584162 6:42978728-42978750 CGTCTCCAGCACCCGCGGTCCGG + Exonic
1016662616 6:146598927-146598949 CGCGTCCAGCGCCCGGAGAGCGG - Intergenic
1017718097 6:157225795-157225817 CGTGTCCAGCACCCACACCCTGG - Intergenic
1018368909 6:163149626-163149648 TGCGGGCAGCACCCGCAGCCCGG - Intronic
1019591955 7:1840001-1840023 CGCATCCAGCACCTGCAGCGGGG + Intronic
1019635275 7:2072123-2072145 CGCGACCAGCACCAGAAGGTGGG + Intronic
1023172098 7:37399490-37399512 CGAGCCCAGCACACGCAGGGTGG + Intronic
1028719407 7:94012043-94012065 CGAGTGCAGCGCCAGCAGGCCGG + Intergenic
1032074540 7:128830276-128830298 CGCGGCCCCCACCCGCGGGCCGG + Intergenic
1036740405 8:11356159-11356181 GGCGTCCAACAGCCACAGGCTGG - Intergenic
1037473914 8:19237706-19237728 GGTGTCCTGCACCCGCTGGCAGG - Intergenic
1037529364 8:19758006-19758028 CACCTCCAGCACACACAGGCAGG + Intronic
1047025082 8:120815148-120815170 CCCGTCCTGCACCCTCAAGCAGG + Intergenic
1049454288 8:142679125-142679147 CTGGTCCAGCTCCCACAGGCAGG - Intronic
1052576587 9:30299450-30299472 CGAGTGCAGCCCCAGCAGGCCGG - Intergenic
1057623241 9:96655156-96655178 GGCGTCCAGCACCGGCAGCTCGG + Exonic
1060151205 9:121289435-121289457 CACAGCCAGCACCAGCAGGCAGG - Intronic
1060545476 9:124456712-124456734 CGCATCCAGCACCGCCATGCTGG + Exonic
1061680929 9:132242127-132242149 CGCTCCCCGCACCCGGAGGCCGG + Exonic
1061903195 9:133683478-133683500 CGACTCCAGCTCCAGCAGGCCGG - Intronic
1203791623 EBV:154696-154718 ATCGTCCAGCACCCGCCTGCAGG + Intergenic
1185457889 X:319678-319700 GGCGTCCAGGACCCCCAGGGCGG - Intergenic
1185523672 X:760792-760814 CACGTCCAGCACCTGGAGGCTGG - Intergenic