ID: 1183293802

View in Genome Browser
Species Human (GRCh38)
Location 22:37018632-37018654
Sequence GCGTCCAGCACCCGCAGGCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 181}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183293794_1183293802 15 Left 1183293794 22:37018594-37018616 CCTTGCGGGCCTCTCGGGTGCCT 0: 1
1: 0
2: 0
3: 8
4: 101
Right 1183293802 22:37018632-37018654 GCGTCCAGCACCCGCAGGCCGGG 0: 1
1: 0
2: 0
3: 19
4: 181
1183293796_1183293802 6 Left 1183293796 22:37018603-37018625 CCTCTCGGGTGCCTGGTGAGTAC 0: 1
1: 0
2: 0
3: 0
4: 63
Right 1183293802 22:37018632-37018654 GCGTCCAGCACCCGCAGGCCGGG 0: 1
1: 0
2: 0
3: 19
4: 181
1183293798_1183293802 -5 Left 1183293798 22:37018614-37018636 CCTGGTGAGTACCAGGACGCGTC 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1183293802 22:37018632-37018654 GCGTCCAGCACCCGCAGGCCGGG 0: 1
1: 0
2: 0
3: 19
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183293802 Original CRISPR GCGTCCAGCACCCGCAGGCC GGG Exonic
900140819 1:1138944-1138966 GGGTCCAGAACCCGCAGGCTGGG - Intergenic
900532515 1:3161674-3161696 GGCTCCAGCCCCAGCAGGCCCGG + Intronic
900540789 1:3201675-3201697 ACTTCCAGCACCTGCAGGGCAGG + Intronic
900577133 1:3388980-3389002 CAGTGCAGCACCCACAGGCCCGG + Intronic
905435078 1:37950409-37950431 GCGCCCAGCACCACCATGCCCGG + Intergenic
907429741 1:54405306-54405328 GCGCCAAGCACCCGGAGTCCAGG - Intronic
907452906 1:54558763-54558785 GCTTCCAGGACCTGCAGGCTGGG + Intronic
913333385 1:117685724-117685746 TCTTCCAGCCCCTGCAGGCCAGG - Intergenic
915916935 1:159945895-159945917 GGGGCCAGCTCCCGCAGCCCTGG - Intergenic
916688126 1:167166352-167166374 GCGTACATCACCCTCAGCCCGGG + Intergenic
920676688 1:208043059-208043081 ACCTCCAGCTCCCGCAGGACGGG + Exonic
1065882944 10:30052634-30052656 GCGTGCAGCACCCGCACTCTGGG - Intronic
1067294922 10:44970084-44970106 GCACCCAACACCCGCAGCCCTGG - Intronic
1067440652 10:46307675-46307697 GAGTCCAGCACCTCTAGGCCAGG + Intronic
1069831468 10:71284716-71284738 ACCTCGCGCACCCGCAGGCCTGG - Exonic
1069874696 10:71554559-71554581 GCCTCCAGCCCCTGCAGCCCTGG + Intronic
1072241168 10:93496726-93496748 GCGGCCAGGACCCGCAGCCCCGG + Exonic
1073812410 10:107164870-107164892 GCCTCCAGCGCCCGGAGACCCGG - Intergenic
1073921712 10:108466555-108466577 GCCTCCAGCGCCCGGAGACCTGG - Intergenic
1074973561 10:118563558-118563580 GCCCCCAGCAGCCTCAGGCCTGG + Intergenic
1075342118 10:121655486-121655508 GCCACGAGCACCAGCAGGCCCGG + Intergenic
1076439714 10:130472893-130472915 GAGTCCAGCAGTCCCAGGCCAGG + Intergenic
1076637747 10:131893360-131893382 CCCTCCACCACCCGCCGGCCAGG + Intergenic
1076870320 10:133189696-133189718 GAGTCCAGCACCGGCTCGCCAGG + Intronic
1076909349 10:133379431-133379453 GCCTCCAGGACCCGCAGGTGCGG - Exonic
1077030126 11:461755-461777 ACGTGCAGAACCTGCAGGCCCGG + Intronic
1077107950 11:849976-849998 GCGCCCCGCACCCGCCGCCCCGG - Intronic
1077220372 11:1413051-1413073 GCGTTCAGAACCCGCATTCCTGG + Intronic
1077560460 11:3257203-3257225 GTGTCCTGCACCAGCTGGCCCGG - Intergenic
1077566356 11:3303020-3303042 GTGTCCTGCACCAGCTGGCCCGG - Intergenic
1079035090 11:17014095-17014117 GCGCCCCCCACCCGCCGGCCCGG + Intronic
1080386962 11:31816101-31816123 GCGTCCAGCCCCTGCACGCGCGG + Intronic
1080774254 11:35371086-35371108 TGGTCCAGCACCTGTAGGCCAGG + Intronic
1082764457 11:57156171-57156193 GCATACAGCACCCGGGGGCCTGG - Intergenic
1083572941 11:63769525-63769547 GGATCCTGCCCCCGCAGGCCTGG + Intergenic
1083639302 11:64136695-64136717 GCTTCCAGGAGCCCCAGGCCCGG + Intronic
1085477265 11:76796376-76796398 AGGTCCAGGACCTGCAGGCCCGG - Exonic
1085824196 11:79825972-79825994 GCCTCCAGAACCAGCAGGCCCGG - Intergenic
1087709168 11:101530031-101530053 AGGTCCACCACCCACAGGCCTGG + Intronic
1089196734 11:116697893-116697915 GCCTCCAGCAGCCCCAGGACAGG + Intergenic
1091080076 11:132658293-132658315 GAGTCCAGCACCTGCAGGTGAGG + Intronic
1091866205 12:3839232-3839254 GCGTCGAGCAGCCGGCGGCCTGG + Intronic
1093182400 12:15981743-15981765 GCGTCCAGCACTACCTGGCCAGG + Intronic
1093206494 12:16257795-16257817 ACATCCAGCACTCACAGGCCTGG - Exonic
1095801037 12:46269683-46269705 GGATCCAGCACCCGCAGACCTGG + Intronic
1096661017 12:53123980-53124002 GAGTCCATCACCCCCAAGCCAGG - Intronic
1101605865 12:106247538-106247560 GCGTCCTGCTCGCGCAGGCTCGG - Exonic
1104031014 12:125065737-125065759 CCGCCCATCCCCCGCAGGCCCGG - Intronic
1104921906 12:132295016-132295038 GAGCCCTGCAGCCGCAGGCCGGG - Intronic
1105845358 13:24289671-24289693 GCGTCCTGGAGCCGCATGCCCGG - Intronic
1114616187 14:24069526-24069548 GCCTCCAGCTCCCCCATGCCTGG - Exonic
1115664952 14:35535340-35535362 CGGATCAGCACCCGCAGGCCAGG + Exonic
1118338920 14:64879237-64879259 GCTCCCAGCACCCGGAGGCCCGG + Intronic
1119400009 14:74356934-74356956 ACTTCCAGCACCTGGAGGCCAGG - Exonic
1121679014 14:95777176-95777198 GGGTCCAGCTCCCCCAGCCCAGG + Intergenic
1122088194 14:99321202-99321224 CTGTGCAGCACCCGCAGGCTCGG + Intergenic
1122153605 14:99737698-99737720 GCGTCCCGCCCCGGCCGGCCTGG - Intronic
1122340224 14:101023198-101023220 GCGACAAGCACACACAGGCCAGG - Intergenic
1122598956 14:102911861-102911883 GCGTGCTGGACCCACAGGCCTGG + Intergenic
1122721820 14:103726563-103726585 GGGTGCATCTCCCGCAGGCCTGG + Intronic
1122884337 14:104703912-104703934 ACGTCCAGCAGCTGCAGCCCTGG - Exonic
1122979060 14:105182936-105182958 GCTTCCAGCAGCAGCAGCCCCGG + Intergenic
1123737024 15:23195479-23195501 GCGCCCACCACCACCAGGCCAGG - Intergenic
1124224704 15:27883108-27883130 GAGAGCAGCACCTGCAGGCCAGG - Intronic
1124287722 15:28418455-28418477 GCGCCCACCACCACCAGGCCAGG - Intergenic
1124288243 15:28424156-28424178 GCGCCCACCACCACCAGGCCAGG - Intergenic
1124294982 15:28493171-28493193 GCGCCCACCACCACCAGGCCAGG + Intergenic
1126690860 15:51288117-51288139 GCTACCAACACCAGCAGGCCAGG - Intronic
1132591492 16:728156-728178 GCGCCCAGCACCGCCAGCCCGGG - Exonic
1132751045 16:1457880-1457902 GGGGCCAGCACCCCCAGGCTGGG + Intronic
1132959126 16:2612450-2612472 GGGTCCAGCGCCCCCATGCCCGG + Intergenic
1132970068 16:2682840-2682862 GTGTGCAGGAGCCGCAGGCCGGG - Intronic
1132972186 16:2694425-2694447 GGGTCCAGCGCCCCCATGCCCGG + Intronic
1133234524 16:4381739-4381761 GCTGCCAGCAGCCGCAGGCGGGG - Exonic
1134092598 16:11399549-11399571 GCGTGAAGGCCCCGCAGGCCTGG + Exonic
1140475754 16:75238567-75238589 CCCCCCAGCAGCCGCAGGCCTGG + Intronic
1141628074 16:85271945-85271967 GCGTCCTGCAGACGCTGGCCTGG - Intergenic
1141693643 16:85610211-85610233 GCGTGCAGCATCCCCAGGGCAGG + Intergenic
1141986886 16:87585894-87585916 GCGTTCAGCACAAGGAGGCCAGG - Intergenic
1142609884 17:1103276-1103298 GCCTCCAGCACACGTAGCCCCGG + Intronic
1146408763 17:32564139-32564161 GGCTCCAGCACCTGCAGGCCAGG - Intronic
1146457500 17:33018948-33018970 GGGTCCAGCACCCACATGCCCGG + Intronic
1152286519 17:79416092-79416114 CCTTCCAGCACCCCCAGGCAGGG + Intronic
1152287796 17:79422586-79422608 GGGTCCAGCAGCCTCAGGCTGGG + Intronic
1153227084 18:2907251-2907273 TAGTCCAGCACACGGAGGCCGGG + Intronic
1153382646 18:4455530-4455552 GCGGGCAGCACTCGCAGGCCAGG - Intergenic
1154256891 18:12789566-12789588 GCGTCCAGCACAGCCAGGCGAGG + Intronic
1155268092 18:24113370-24113392 GGGTCCCCCACCCGCAGACCTGG - Intronic
1160610358 18:80079729-80079751 GCGTTCAACACACACAGGCCAGG - Intronic
1160715210 19:573220-573242 GAGTCCAGCCCCAGCAGGACGGG - Intronic
1160744573 19:704558-704580 GACTCCAGCACACACAGGCCTGG - Intergenic
1161130976 19:2588533-2588555 GCGTCCAGCTGCCGCCGCCCTGG - Intronic
1162854633 19:13459016-13459038 GCATCTAGCACACACAGGCCAGG - Intronic
1164586757 19:29480597-29480619 GAGTCCAGCACCCGGAATCCAGG + Intergenic
1167278389 19:48552414-48552436 GCCACCCGCAGCCGCAGGCCTGG + Intronic
1167593772 19:50417317-50417339 GGGTCCACAACCCACAGGCCTGG - Intronic
1168406813 19:56114781-56114803 GTGTCCAGCACCTGCTGCCCTGG + Intronic
1168637787 19:58009846-58009868 GGGTCCAGGACCCGCTGGGCTGG - Exonic
925900723 2:8507579-8507601 ACGTTCAGCTCCCCCAGGCCAGG + Intergenic
926217234 2:10913039-10913061 GCGTCCAGCACCTGCAGCTCGGG - Exonic
931178572 2:59877370-59877392 GAGTCCAGCACTCCCAGGACTGG - Intergenic
934567149 2:95347182-95347204 GGGACCAGTACCCGCACGCCGGG + Intronic
934757201 2:96832551-96832573 GGGTCCAGCCACAGCAGGCCCGG + Exonic
936561297 2:113541827-113541849 GCGCCCTGCACCCGCCCGCCTGG - Intergenic
944242442 2:197499630-197499652 GAGGCCTGGACCCGCAGGCCTGG + Intronic
945245276 2:207711788-207711810 GCGGCCGGCACCGGCAGCCCCGG - Exonic
947122934 2:226836154-226836176 GCCGCCAGCTCCCGCAGCCCGGG - Intronic
947549836 2:231038037-231038059 GCCTCCAGCAGCCGCAGCCCCGG - Exonic
947587825 2:231367470-231367492 GCGGCCAGCACCAGCTAGCCTGG - Intronic
947999622 2:234557166-234557188 GCATCCTGCACCCTGAGGCCTGG + Intergenic
1169026380 20:2374992-2375014 GGGTCCAGCAACCACAGACCTGG - Intergenic
1170651307 20:18245185-18245207 GCCTCCATCACCTGCAGACCAGG - Intergenic
1171135528 20:22691544-22691566 GGGTCTAGCAGCAGCAGGCCTGG - Intergenic
1171391996 20:24807552-24807574 GCGTTCAGCAGCGGCAGGACTGG - Intergenic
1175215757 20:57391183-57391205 GCGCCCAGCGCCCCCAGGCCCGG + Intergenic
1175754390 20:61520288-61520310 GGGTCCAGCACCAGCAGGACTGG - Intronic
1176055227 20:63141718-63141740 GAGTCCAGCATCTGCAGGCTGGG - Intergenic
1176061945 20:63176301-63176323 GCTGCCGGCACCCGCAGGCTTGG + Intergenic
1176159530 20:63641387-63641409 GCGTGCAGCTCCTGCAGGACAGG + Exonic
1176289220 21:5035398-5035420 ATGTCCAGCAGGCGCAGGCCTGG + Intronic
1179022993 21:37656664-37656686 CCGTCCAGCTCAGGCAGGCCGGG - Intronic
1179514514 21:41897563-41897585 GCATCAAGCACCCCAAGGCCAGG + Intronic
1179868015 21:44228206-44228228 ATGTCCAGCAGGCGCAGGCCTGG - Intronic
1179968050 21:44818159-44818181 GCGTCGGGCGCGCGCAGGCCGGG + Intronic
1180073259 21:45449248-45449270 GCTTCCAGCTGCCGCCGGCCAGG + Intronic
1181017988 22:20082200-20082222 GCGTCCACCACCACCACGCCCGG + Intronic
1181963884 22:26643091-26643113 GGATTCACCACCCGCAGGCCGGG - Intergenic
1182108704 22:27707417-27707439 GGGACCAGCACACCCAGGCCAGG - Intergenic
1183293802 22:37018632-37018654 GCGTCCAGCACCCGCAGGCCGGG + Exonic
1185087219 22:48747328-48747350 GCTTCCTGCACCCCAAGGCCAGG - Intronic
949950036 3:9221389-9221411 GCGTGCACCACCACCAGGCCTGG - Intronic
959398242 3:105868563-105868585 AAGACCAGAACCCGCAGGCCGGG - Intronic
961547994 3:127649299-127649321 GGGTCCAGCACCCACATGGCAGG - Intronic
962203711 3:133418519-133418541 GCATCCAGCCCACCCAGGCCAGG + Intronic
962240303 3:133746335-133746357 GCGCCCAGCCCGCCCAGGCCGGG + Exonic
962398980 3:135040955-135040977 GCGTCCAGCTGCAGAAGGCCTGG + Intronic
966917056 3:184590859-184590881 GCTTCCTGCTCCCGCAGGCTCGG + Intronic
968189883 3:196660037-196660059 AAGTCCAGCCTCCGCAGGCCCGG - Exonic
968513167 4:1004115-1004137 GCGCCCACCACCCGCTGCCCTGG + Intronic
968807993 4:2787585-2787607 GGGTCCTCCACCCACAGGCCTGG + Intergenic
970770483 4:19606370-19606392 GCGTCAAGGACCTGCAGCCCTGG - Intergenic
972245866 4:37244888-37244910 GCGCACAGCACCCGCCGGCGAGG - Exonic
981475075 4:145180024-145180046 GCGTCGAGCAGCCGGCGGCCTGG - Intronic
984091958 4:175386590-175386612 GCGTGCAGCACCACCAGGCCTGG - Intergenic
984271867 4:177557603-177557625 GCGACAGGCACCGGCAGGCCAGG + Intergenic
985676275 5:1232835-1232857 CCTTCCAGCACCCGCTGCCCTGG + Exonic
985747677 5:1656360-1656382 GCGGCCCGCACCTGCAGGCCGGG - Intergenic
986029216 5:3880019-3880041 GGGTGCAGCACCCCCAGGGCAGG - Intergenic
988605954 5:32678606-32678628 GCATGCAGCACTCGCAGGCCTGG - Intergenic
990820910 5:59839255-59839277 CCCTCCAGCAGCCACAGGCCTGG - Intronic
996379104 5:122845730-122845752 GGGCGCAGCAGCCGCAGGCCTGG - Intronic
999824479 5:155260870-155260892 GCATCCAGCTCCCGCAGTGCAGG - Intergenic
1002183508 5:177443288-177443310 GCGTCCAGGTAACGCAGGCCTGG - Intergenic
1002196641 5:177504831-177504853 GGGCCCAGCACCAGCAGGGCCGG + Exonic
1002576105 5:180175060-180175082 GCGGCCAGCACCTGCTGCCCAGG + Intronic
1006119565 6:31795745-31795767 CCCGCCAGGACCCGCAGGCCCGG - Exonic
1007584163 6:42978729-42978751 GTCTCCAGCACCCGCGGTCCGGG + Exonic
1007743668 6:44029051-44029073 GCTTCCAGCCCCTGCTGGCCAGG + Intergenic
1011099673 6:83708280-83708302 TAGTCCAGCACCCGCGGGTCAGG - Intronic
1012548781 6:100449224-100449246 GCGTCGAAGAGCCGCAGGCCAGG - Intronic
1016662615 6:146598926-146598948 GCGTCCAGCGCCCGGAGAGCGGG - Intergenic
1016834555 6:148464465-148464487 GCGCCCACCATCCTCAGGCCTGG + Intronic
1017136056 6:151148285-151148307 GTGTCATGCAGCCGCAGGCCAGG - Intergenic
1017793921 6:157823936-157823958 GCCGCGAGCCCCCGCAGGCCGGG - Intronic
1018368908 6:163149625-163149647 GCGGGCAGCACCCGCAGCCCGGG - Intronic
1018383730 6:163284289-163284311 ACGTCCAGCAGCTGCTGGCCTGG - Intronic
1019486341 7:1291092-1291114 GGGCCCAGGACCTGCAGGCCAGG + Intergenic
1021122807 7:16816052-16816074 GCCTCCTCCACCCGCAGGGCAGG - Intronic
1022517878 7:30987330-30987352 GCGCCCACCCCCAGCAGGCCAGG - Intronic
1025941527 7:66079053-66079075 GCGCCCAACACCCCCATGCCTGG + Intronic
1026319756 7:69258311-69258333 GCATCCAGCACTCCCTGGCCAGG - Intergenic
1029128598 7:98312871-98312893 CCCTCCAGCACCCACAAGCCTGG + Intronic
1029704151 7:102267045-102267067 GGGGCCAGCACCTGCAGGCATGG + Intronic
1031887015 7:127253467-127253489 GCGGGCAGCACCCGCGAGCCCGG + Intergenic
1032074541 7:128830277-128830299 GCGGCCCCCACCCGCGGGCCGGG + Intergenic
1034441378 7:151087497-151087519 GGGCCCAGCGCCCGCAGGCCCGG + Intronic
1034458991 7:151187638-151187660 GCCTCCAGATCCGGCAGGCCGGG + Intronic
1035290870 7:157837658-157837680 GCATCCAGCCCCCGCAGGGCAGG + Intronic
1035401661 7:158569962-158569984 GCGAGCGGCACCCGCTGGCCAGG - Intronic
1036740404 8:11356158-11356180 GCGTCCAACAGCCACAGGCTGGG - Intergenic
1049879692 8:145053193-145053215 TCTGCCAGCACCTGCAGGCCAGG - Intronic
1049891391 9:73512-73534 GCGCCCTGCACCCGCCCGCCCGG + Intergenic
1054695609 9:68356969-68356991 GCGCCCTGCACCCGCCCGCCTGG - Exonic
1057094385 9:92292574-92292596 GCATCCAGCAACCACAGGGCAGG + Intronic
1057807073 9:98227136-98227158 GCGTCCAGCAGCCTCAGAACTGG + Intronic
1058532403 9:105919614-105919636 GCCTCCAGCACCCCATGGCCAGG + Intergenic
1059429472 9:114241267-114241289 GCTTCCCGCACCCTCAGCCCAGG - Intronic
1060237821 9:121878518-121878540 GCCTGCAGCAACCCCAGGCCTGG - Intronic
1060855979 9:126915153-126915175 GCGCCGGGCACCCGCAGGCACGG - Intronic
1061196632 9:129110444-129110466 CCGTCCAGGGCCCTCAGGCCCGG + Intronic
1061680930 9:132242128-132242150 GCTCCCCGCACCCGGAGGCCGGG + Exonic
1061858604 9:133456498-133456520 GGGTCCAGCACTCCCACGCCTGG - Intronic
1061903194 9:133683477-133683499 GACTCCAGCTCCAGCAGGCCGGG - Intronic
1061907776 9:133707688-133707710 GCGTCCAGCACGAGATGGCCAGG + Intronic
1062580164 9:137225851-137225873 CCATCCAGAACCAGCAGGCCTGG + Exonic
1203791624 EBV:154697-154719 TCGTCCAGCACCCGCCTGCAGGG + Intergenic
1185457867 X:319616-319638 GCGTCCAGGACCCCCATGGCTGG - Intergenic
1185457888 X:319677-319699 GCGTCCAGGACCCCCAGGGCGGG - Intergenic
1185457949 X:319861-319883 ACGTCCAGGACCCCCAGGGCTGG - Intergenic
1191897792 X:66012220-66012242 GTGTAGGGCACCCGCAGGCCAGG - Intergenic
1199594247 X:149494063-149494085 GCCTCCAGCCCCAGCAGCCCAGG - Intronic