ID: 1183293808

View in Genome Browser
Species Human (GRCh38)
Location 22:37018655-37018677
Sequence CCCCAGCTTGCCAGTCCTGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 1, 2: 1, 3: 28, 4: 184}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183293803_1183293808 -4 Left 1183293803 22:37018636-37018658 CCAGCACCCGCAGGCCGGGCCCC 0: 1
1: 0
2: 6
3: 51
4: 497
Right 1183293808 22:37018655-37018677 CCCCAGCTTGCCAGTCCTGATGG 0: 1
1: 1
2: 1
3: 28
4: 184
1183293804_1183293808 -10 Left 1183293804 22:37018642-37018664 CCCGCAGGCCGGGCCCCAGCTTG 0: 1
1: 1
2: 3
3: 24
4: 378
Right 1183293808 22:37018655-37018677 CCCCAGCTTGCCAGTCCTGATGG 0: 1
1: 1
2: 1
3: 28
4: 184
1183293796_1183293808 29 Left 1183293796 22:37018603-37018625 CCTCTCGGGTGCCTGGTGAGTAC 0: 1
1: 0
2: 0
3: 0
4: 63
Right 1183293808 22:37018655-37018677 CCCCAGCTTGCCAGTCCTGATGG 0: 1
1: 1
2: 1
3: 28
4: 184
1183293798_1183293808 18 Left 1183293798 22:37018614-37018636 CCTGGTGAGTACCAGGACGCGTC 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1183293808 22:37018655-37018677 CCCCAGCTTGCCAGTCCTGATGG 0: 1
1: 1
2: 1
3: 28
4: 184
1183293799_1183293808 7 Left 1183293799 22:37018625-37018647 CCAGGACGCGTCCAGCACCCGCA 0: 1
1: 0
2: 0
3: 9
4: 94
Right 1183293808 22:37018655-37018677 CCCCAGCTTGCCAGTCCTGATGG 0: 1
1: 1
2: 1
3: 28
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183293808 Original CRISPR CCCCAGCTTGCCAGTCCTGA TGG Exonic
901068858 1:6507494-6507516 CCCCAGCCTGCCAGGTCTGAAGG + Intronic
901629993 1:10643341-10643363 CCCCAGCTGGCCAGCGCTCATGG + Intronic
901633698 1:10659929-10659951 CCCCACCTTGCCTGTCTTGAAGG + Exonic
901701471 1:11046865-11046887 CCCCAGCCCTCCCGTCCTGACGG + Intronic
902545908 1:17190316-17190338 CCTCAGGCTGCCAGCCCTGATGG + Intergenic
902818890 1:18931531-18931553 CCCCTGGATGCCAGTGCTGAAGG - Intronic
903069428 1:20719490-20719512 GCCCAGGTTGCCAGTGCAGAAGG + Intergenic
903367023 1:22811468-22811490 CCCAAGCTTGTCTGTCCTCATGG + Intronic
904732563 1:32606058-32606080 CCACAGCCTGCCAGTCCACATGG - Intronic
905415302 1:37799837-37799859 TCACAGCTTTCCAGTTCTGATGG - Exonic
905478460 1:38245182-38245204 GCCCAGCTTCCCAGCCCTCATGG - Intergenic
908452323 1:64268378-64268400 CCCCAGCTGGCCAGGCGTGGTGG + Intergenic
912500985 1:110121711-110121733 CCCCAGACTCCCTGTCCTGATGG - Intergenic
918310800 1:183283922-183283944 CCCCATGTTGCCTGTCGTGAAGG + Intronic
919906552 1:202082443-202082465 CCACAGCCAGCCAGACCTGAAGG + Intergenic
920228549 1:204455376-204455398 CCCCAGCATCCAAGGCCTGAGGG - Intronic
920917932 1:210272997-210273019 CCCCAGCTGGCCTGTGCTAATGG - Intergenic
921849356 1:219918351-219918373 CCCCAGCCTGACTGTCCTCATGG - Exonic
923455730 1:234163561-234163583 GCCCAGCTTGCCATGCCTGAGGG + Intronic
1064288198 10:14011117-14011139 GCCCAGCTTGCCTGTCCTACAGG + Intronic
1065140719 10:22715494-22715516 ACCCAGCTCACCAGTCCTCACGG + Intergenic
1065287333 10:24198785-24198807 CCCCAGTTTGCCAGTGGTGGAGG - Intronic
1066417267 10:35232938-35232960 CCCCAGTGTGGCAGTCGTGAGGG + Intergenic
1067374953 10:45719321-45719343 CTCCAGCTTGCCGATCCTGGGGG + Intergenic
1067551811 10:47241695-47241717 CCGCATCTTGTCACTCCTGAGGG - Intergenic
1067725575 10:48768255-48768277 CCTCAGATTGCCAGTCCTGGAGG - Intronic
1067882766 10:50060962-50060984 CTCCAGCTTGCCAATCCTGGGGG + Intergenic
1067886476 10:50093880-50093902 CTCCAGCTTGCCGATCCTGGGGG - Exonic
1070016803 10:72541648-72541670 CCCTAGCTTCTCAGTCCTTAGGG + Intronic
1071478358 10:86043518-86043540 CCCCAGCCTGCCAGTAATGAGGG - Intronic
1072693789 10:97588664-97588686 CCTCATCTTCCCAGTCCTGCTGG - Intronic
1077452866 11:2661481-2661503 CCCAGGCTTGCCATTCCTCATGG + Intronic
1077857104 11:6138907-6138929 CCCTGCCTTGCCAGACCTGATGG + Intergenic
1083412271 11:62502202-62502224 CCCCAGCAGGGCAGTCCTGGGGG + Intronic
1089127314 11:116185787-116185809 CCCCAGGTTACCTGTCCAGATGG - Intergenic
1092285295 12:7125199-7125221 ACCCAGCTTTCCACTCCTAAAGG + Intronic
1094807094 12:34105488-34105510 CCCCAGCTTCTCAGCCCTCAGGG - Intergenic
1096255890 12:50062219-50062241 CTCCAGCTCCCCAGTCCTAAGGG + Intronic
1097793382 12:63838867-63838889 CCACAGCTAGCCAGGCCTGGTGG + Intergenic
1098659627 12:73075793-73075815 GTCCAGCATGCCTGTCCTGATGG - Intergenic
1100458103 12:94772310-94772332 TCCCAGCTTGTCAGCCCTCAGGG + Intergenic
1101415309 12:104503667-104503689 GGCCAGCTTCCCAGTCCTGCAGG - Intronic
1102420759 12:112801069-112801091 CCCCAGCTTGCCACTTCACAGGG - Intronic
1102551466 12:113695084-113695106 CCCCAGCTGCTCAGGCCTGAGGG + Intergenic
1106107030 13:26742076-26742098 CCTCAGCTTCCCAGCCCTCAGGG - Intergenic
1107016128 13:35708981-35709003 CCCCACCATGACAGTCATGAGGG + Intergenic
1108822734 13:54373556-54373578 CCCCAGCATACCACTCCTAAAGG + Intergenic
1109562716 13:64075022-64075044 ACCCAGCCTGCCAGGCCTGGTGG - Intergenic
1113452316 13:110419969-110419991 CCCCATCCTGGCATTCCTGAGGG - Intronic
1113709242 13:112453049-112453071 CCCCTGCTTCCTAGTCCTGACGG - Intergenic
1116594974 14:46829580-46829602 CCTCAGCTTTCCATCCCTGAGGG - Intergenic
1117511230 14:56453395-56453417 CTCCAGCTTTCCAGCTCTGAGGG - Intergenic
1118714882 14:68552198-68552220 CCTCTGCTTGCCTGGCCTGAGGG + Intronic
1119743324 14:77027852-77027874 CCCCAGCCGGCCAGTCCTCCCGG - Exonic
1120846020 14:89125860-89125882 TCCCTGCTGGCCAGCCCTGAGGG + Intronic
1121738369 14:96234481-96234503 CCCCTGCTTGGGAGCCCTGATGG - Intronic
1123467290 15:20526578-20526600 CCCCAGCTTCCCAGACCAGTGGG - Intergenic
1123650824 15:22474464-22474486 CCCCAGCTTCCCAGACCAGTGGG + Intergenic
1123741233 15:23283306-23283328 CCCCAGCTTCCCAGGCCAGTGGG + Intergenic
1123745764 15:23319252-23319274 CCCCAGCTTCCCAGGCCAGTGGG - Intergenic
1124278036 15:28342569-28342591 CCCCAGCTTCCCAGGCCAGTGGG - Intergenic
1124304666 15:28569039-28569061 CCCCAGCTTCCCAGACCAGTGGG + Intergenic
1125828313 15:42693896-42693918 CCTCAGGTTGGCAGGCCTGAGGG - Exonic
1127959835 15:63882532-63882554 CCTCAGCCTGCCAGGCCTGAGGG - Intergenic
1128557448 15:68641410-68641432 CCCCAGCTCCCCAGTCCTCAGGG - Intronic
1128647461 15:69387932-69387954 CCCCAGCCTGCCAGCCATGCTGG + Intronic
1129198169 15:73983310-73983332 CCCCAGCTCGCCAGGCATGCAGG + Exonic
1130708500 15:86256016-86256038 CCCCAGTTTGCTATTCCTAAAGG - Intronic
1131385570 15:92003888-92003910 CCCCAGCTGCGCAGTGCTGATGG - Intronic
1132461816 16:59189-59211 CCCCAGCCAGCCAATCCTGAGGG + Intronic
1132544018 16:524831-524853 CCCCAGCCTGCCTCTGCTGAAGG + Intergenic
1137774354 16:51043084-51043106 GCCCAGCTTTCTAGTCCTGATGG + Intergenic
1139743765 16:69057996-69058018 CCCCAGCTTGGCAGCCCTGAAGG - Intronic
1141230592 16:82163450-82163472 ACCCAGCTAGTCAGTGCTGAAGG - Intronic
1141426405 16:83947228-83947250 CCCCAGCCCGCAGGTCCTGAAGG - Intronic
1141758694 16:86012386-86012408 ACTCAGCTTCCCACTCCTGATGG - Intergenic
1141892101 16:86933176-86933198 CCCCATCTTTCCAGCCCTAAAGG - Intergenic
1142284783 16:89167317-89167339 CCCCACCTTCCCAGTGCTCAGGG + Intergenic
1142743470 17:1943378-1943400 CCCCAACTTGCCAGCACCGAAGG + Intronic
1143524064 17:7462388-7462410 CCCCCGCTTGCCACTACTGGGGG + Exonic
1144705368 17:17364315-17364337 CCCCAGATTCCCAGGCCTGGAGG + Intergenic
1145751841 17:27360957-27360979 ACCCAGCCTGCCAGGCCTGGTGG + Intergenic
1146182209 17:30705722-30705744 CCCCAACCTCACAGTCCTGAAGG - Intergenic
1147754322 17:42758362-42758384 CCCCTGTTTTCCACTCCTGAGGG - Intergenic
1148489111 17:48012002-48012024 CCCCAGCCTGCCATCCTTGATGG - Intergenic
1149999536 17:61425041-61425063 CCCCAGCATGCCAGGCCTTTGGG + Intergenic
1150229812 17:63543822-63543844 CCCCAGTCTCCCAGTCCTGATGG + Intronic
1152100281 17:78297533-78297555 CCTCAGCCTGCCACTCCTGATGG + Intergenic
1152495314 17:80667099-80667121 TCCCAGCGTGCCAGTGCTGATGG + Intronic
1152611606 17:81317598-81317620 CTCCGGCAAGCCAGTCCTGAGGG - Intronic
1153972459 18:10238941-10238963 CCCCAGGTTTTCAGTTCTGAAGG - Intergenic
1155359233 18:24983532-24983554 CCCAAGCTGGCCAGCCCTGTGGG - Intergenic
1160374693 18:78402489-78402511 CTCCAGCTTTCCCTTCCTGAGGG + Intergenic
1161299760 19:3537079-3537101 CCCCATCTGGCCAGCCCTGGGGG - Intronic
1161572765 19:5039599-5039621 ACCCAGCTTCCCAGGCCTGGAGG + Intronic
1162799373 19:13102574-13102596 GCCCAGACTGCCAGCCCTGACGG - Exonic
1162976623 19:14210080-14210102 CCCCAGCCTCACAGTCCTGAAGG + Intergenic
1163511955 19:17740857-17740879 CCCCAGCTTGGCAGCACTGCTGG + Intergenic
1163583290 19:18150888-18150910 CTCCAGTATGCCAGTCCTGCGGG + Exonic
1165448665 19:35870103-35870125 CCCCATCTTGCTGGTCCTTAAGG - Intronic
1167071080 19:47222253-47222275 CCTCATCTTGCCAGCCCTGTAGG - Intronic
1168410078 19:56134322-56134344 ACCCTGCTTCCCAGGCCTGAGGG - Intronic
1168618472 19:57857205-57857227 CCCCAGCATGGCACTCCTGAGGG - Intronic
1168625030 19:57911401-57911423 CCCCAGCATGGCACTCCTGAGGG + Intronic
1168679246 19:58301629-58301651 CCCAAAATGGCCAGTCCTGAAGG + Exonic
925922503 2:8647002-8647024 GCCAAGCTTGCCACTTCTGATGG + Intergenic
927053338 2:19350267-19350289 CCCCTGCTGGCCAGCCCTGGAGG - Intergenic
927856246 2:26529720-26529742 TCCTCCCTTGCCAGTCCTGAAGG - Intronic
929692586 2:44086994-44087016 TCCCAGATTTCCAGTCCTGGAGG - Intergenic
930234764 2:48877956-48877978 CCACAGCTTGCCTGTCCTCAGGG - Intergenic
930261589 2:49153329-49153351 TCCCAACTTGCCAGTTCTCAGGG + Intronic
932724136 2:74163346-74163368 CAACAGCTGGCCAGTCCTGGTGG + Intronic
934843875 2:97649168-97649190 CCTCATCTTGCCCATCCTGAAGG + Intergenic
935134809 2:100290756-100290778 CACCAGCTGGGCAGTCCTGATGG - Intronic
937814691 2:126238138-126238160 CCCCTCCCTGCCAGTCCTCAGGG + Intergenic
937849060 2:126616828-126616850 AATCACCTTGCCAGTCCTGAGGG - Intergenic
944423801 2:199558167-199558189 CCCCTGCCTGGCAGACCTGAAGG - Intergenic
945137335 2:206642407-206642429 CCCCAGCTTCCGCGTCCTGGAGG - Intergenic
946140922 2:217690040-217690062 CCCCAGCTTGCCTGTCTCTATGG + Intronic
946187311 2:217988340-217988362 CCCCAGCTGACCTGGCCTGAGGG - Intronic
946392916 2:219427015-219427037 CCCCAGCCTGGCTGACCTGAAGG - Intergenic
948399899 2:237676369-237676391 TCCCATGTTGCCGGTCCTGATGG + Intronic
948601706 2:239111318-239111340 CCCCAGCATGACAGAACTGAAGG + Intronic
1169129958 20:3161368-3161390 CCCCAGGCTGCCATTCCTGAGGG + Intergenic
1171028520 20:21654595-21654617 CCCCAGCTTGCCAGTTTTCCTGG - Intergenic
1172222875 20:33285817-33285839 CCCCAGCTTCCCAGAGTTGAGGG - Intronic
1172271808 20:33659362-33659384 CACCTGCTTGCCAGGCCTGGGGG + Intronic
1173109846 20:40176368-40176390 TCCCAGGTTGCATGTCCTGAAGG - Intergenic
1175985140 20:62760828-62760850 CCCCAGCTTGCCAGGCCTGAAGG - Exonic
1176099939 20:63360358-63360380 CCCCAGCCTGCCCGTGCTGTTGG + Intronic
1178115458 21:29412216-29412238 CCCCTGCTTCCCAGTTCTGGAGG - Intronic
1179997337 21:44980144-44980166 CCCCACCCTGCCAGTCCCGCAGG + Intergenic
1180865297 22:19115260-19115282 CCCCAGCAAGCCGGTGCTGAGGG - Intronic
1181670626 22:24424073-24424095 CCCCAGCCTCCCAGTCCTCCCGG - Intronic
1182005156 22:26953538-26953560 CCCCAGCTCACCAGGCTTGAGGG - Intergenic
1182650407 22:31846996-31847018 CCCCACCTTGACAGCCCTGAGGG + Intronic
1183232316 22:36590738-36590760 CTCCAGCTTCCCAGTGCTGTCGG + Intronic
1183293808 22:37018655-37018677 CCCCAGCTTGCCAGTCCTGATGG + Exonic
1183425211 22:37735421-37735443 CCCCAGCTTGCCAGAGCTGCAGG + Exonic
1183813836 22:40281934-40281956 CCTCACCTTGCCAGGCCTGAGGG + Intronic
1203293949 22_KI270736v1_random:22511-22533 CCCCAGCCTGACACTCATGAAGG + Intergenic
949891939 3:8739841-8739863 GCTCAGCTTGGCAGTCCTGCTGG + Intronic
950009503 3:9712840-9712862 CCCCAGCCTAACAGCCCTGATGG - Intronic
951061160 3:18208700-18208722 CCCCATGTTGCCAGTGCTCAGGG - Intronic
952959474 3:38580527-38580549 CTCTACCTTGCCAGTCCTGGAGG + Intronic
953172940 3:40524523-40524545 CCTCAGCTGGGCAGTCCTCAGGG - Intergenic
953919974 3:46944983-46945005 CACCATCTGGCCAGTCCTAAAGG + Intronic
954137387 3:48588282-48588304 CCTCAGGTTGCCAGTGCAGAAGG + Exonic
961043268 3:123692443-123692465 CCCCAGCTTCCCAGCTCAGAAGG + Intronic
961591051 3:127982282-127982304 CCCAGGCTGGCCAGTCCTTAAGG + Intronic
961787108 3:129353835-129353857 CCCCAGCTTGCCCGGCCAGTGGG - Intergenic
962329779 3:134467426-134467448 CCCCAGCTTCCAGGTCATGAGGG - Intergenic
968727646 4:2255733-2255755 GCCCAGCGTGCTAGTCCTGCAGG - Intronic
973052001 4:45608915-45608937 CCCCATCTTGATAGTCCTGGTGG - Intergenic
974722020 4:65752574-65752596 TCCCAGCCTGCCTTTCCTGATGG + Intergenic
976862804 4:89687085-89687107 GACCAGCTTGCCACTCCTGGAGG - Intergenic
977754521 4:100651711-100651733 CCCAGGGTTGACAGTCCTGAAGG + Intronic
978631594 4:110753320-110753342 CACTAGCTTGCCAATCATGATGG - Intergenic
982404897 4:155008766-155008788 CCACAACGTGACAGTCCTGATGG - Intergenic
986215099 5:5712698-5712720 CCCCAGCCTTCAAGCCCTGAAGG + Intergenic
986760954 5:10879151-10879173 CCCCTGCTTTAAAGTCCTGAAGG + Intergenic
990557479 5:56951345-56951367 CCCCAGCTCACCAGTCCCGGGGG + Intronic
991087403 5:62660767-62660789 CCGCAGGTTTCCAGGCCTGAGGG - Intergenic
992472646 5:77073901-77073923 CACTAGCTGGCCTGTCCTGAGGG + Exonic
997125951 5:131227048-131227070 CAGCAGCTGGCCAGTCCAGAGGG + Intergenic
999314561 5:150575449-150575471 CCCCAGCCTGCCAGGCCTGTGGG - Intergenic
1001137680 5:169116016-169116038 TCCCAGCTAGCCAATGCTGATGG + Intronic
1003195321 6:3909243-3909265 ACCCAGCCTGGCAGTCCTCAGGG + Intergenic
1005048356 6:21663340-21663362 CCCCACTTTGCCAGTGCAGAGGG - Intergenic
1006407757 6:33855198-33855220 CCCCAGCCTCCCGGGCCTGAGGG - Intergenic
1007631449 6:43275468-43275490 CCCCAGCCTGGCAGCACTGAGGG - Intronic
1013980311 6:116121194-116121216 ACCAGGCTTGCCAGGCCTGAAGG - Exonic
1014007374 6:116435715-116435737 CCCCAGTTTTCCAGACTTGAAGG - Exonic
1015176218 6:130311986-130312008 CCCCCACTTGCCATACCTGAGGG + Intronic
1016319032 6:142821906-142821928 CCCCTGCTTTCCAGGCCTGGAGG - Intronic
1016881119 6:148913151-148913173 CCTCAGCTTGCCAATCATTAGGG + Intronic
1018802682 6:167236069-167236091 ACCAAGCCTGCCATTCCTGAGGG - Intergenic
1019736457 7:2652339-2652361 CCCCAGTTCCCCAGTCCTGCAGG - Intronic
1023968682 7:44976731-44976753 CCCCATCTTGCCAGTCTTGGGGG - Intronic
1026079110 7:67201381-67201403 CCTCAGATTGCTAGACCTGAGGG - Intronic
1026697713 7:72610569-72610591 CCTCAGATTGCTAGACCTGAGGG + Intronic
1029535575 7:101155361-101155383 CCCCAGCTTCCCAGTTCCGGGGG - Intronic
1030878664 7:114848907-114848929 CACCTGCTTGGCAGTCATGAGGG + Intergenic
1033210171 7:139454301-139454323 TCCCAGCTGGCCAATCCAGAAGG + Intronic
1034214801 7:149397151-149397173 CCCCAGCTTGGAAGCCTTGAGGG + Intergenic
1034269169 7:149795332-149795354 CTCCAGCGTGCCATCCCTGAGGG - Intergenic
1034407079 7:150911752-150911774 CCCCAGCCTGCCACTTCTGCAGG - Intergenic
1034967579 7:155400701-155400723 CGCCTGGGTGCCAGTCCTGAAGG - Intergenic
1035735274 8:1882908-1882930 CCCCAGCCTCCCCGTCCTGCAGG + Intronic
1037583973 8:20263771-20263793 GCCCTGCTTGCCAGTCCAGAGGG - Intronic
1037959170 8:23083737-23083759 CCCCAGCAGGCCAAGCCTGAAGG - Intergenic
1038407785 8:27334827-27334849 GCCCTTCTTGCCTGTCCTGAAGG + Intronic
1040845670 8:51836162-51836184 TCCCAGCTTGCCATTTCTCAGGG - Intronic
1045335948 8:101205070-101205092 CCCCATCTAGCCAGTCCTCACGG + Exonic
1047931339 8:129731376-129731398 TCCTGGCTTACCAGTCCTGAGGG - Intergenic
1048331852 8:133476019-133476041 CACCATCTTCGCAGTCCTGATGG + Exonic
1049268255 8:141681043-141681065 CCCCTGCCTGCGAGTCCTGCTGG - Intergenic
1050316944 9:4412178-4412200 CTCCACCTTGCTAGGCCTGAAGG - Intergenic
1054458692 9:65450321-65450343 CCTCTGCCTGCCTGTCCTGAAGG - Intergenic
1056118169 9:83461461-83461483 ACCCAGGATGCCAGTCTTGAGGG + Intronic
1056329719 9:85511332-85511354 CCCCAGCTGGCAAGCTCTGAAGG + Intergenic
1057026988 9:91741443-91741465 CACCATCTTGCCAGTCTTGGTGG - Intronic
1057927922 9:99169485-99169507 CCCCAGCCTTCCTTTCCTGACGG - Intergenic
1062388450 9:136324514-136324536 CCCCAGCTCCCCACTCCTGGGGG + Intergenic
1188309264 X:28597170-28597192 CTCCTGCTTGCCAGACATGAAGG - Intronic
1189561277 X:42193758-42193780 CACCAGCATGCCTGGCCTGATGG - Intergenic
1190055955 X:47181208-47181230 CCCCACCTTGGGAGGCCTGAAGG - Exonic
1192123395 X:68477600-68477622 CACCAGCTTTCCAGTCCTTCAGG + Intergenic
1192186174 X:68948224-68948246 CCCCAGATGGCCATTCCTGCCGG - Intergenic
1192449481 X:71234922-71234944 TCCCAGCTTGCCAGAACTGAGGG + Intergenic
1199156013 X:144550300-144550322 CACCAAGTTGCCAGTGCTGAGGG - Intergenic
1199597162 X:149515234-149515256 CCATAGGTTTCCAGTCCTGAAGG - Intronic
1200254147 X:154570503-154570525 TCCCAGCTTGGCAGTCCAAACGG + Intergenic
1200263622 X:154633905-154633927 TCCCAGCTTGGCAGTCCAAACGG - Intergenic
1201933836 Y:19384938-19384960 CCCCTGCAAGGCAGTCCTGAAGG + Intergenic