ID: 1183295547

View in Genome Browser
Species Human (GRCh38)
Location 22:37027316-37027338
Sequence TAGTAACCCCTGCCTCAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 91}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183295544_1183295547 3 Left 1183295544 22:37027290-37027312 CCAGTCCTGCATGAAAATGGGAA 0: 1
1: 0
2: 1
3: 11
4: 159
Right 1183295547 22:37027316-37027338 TAGTAACCCCTGCCTCAAGGTGG 0: 1
1: 0
2: 0
3: 2
4: 91
1183295545_1183295547 -2 Left 1183295545 22:37027295-37027317 CCTGCATGAAAATGGGAATGTTA 0: 1
1: 0
2: 1
3: 21
4: 213
Right 1183295547 22:37027316-37027338 TAGTAACCCCTGCCTCAAGGTGG 0: 1
1: 0
2: 0
3: 2
4: 91
1183295543_1183295547 4 Left 1183295543 22:37027289-37027311 CCCAGTCCTGCATGAAAATGGGA 0: 1
1: 0
2: 0
3: 11
4: 164
Right 1183295547 22:37027316-37027338 TAGTAACCCCTGCCTCAAGGTGG 0: 1
1: 0
2: 0
3: 2
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183295547 Original CRISPR TAGTAACCCCTGCCTCAAGG TGG Intronic