ID: 1183297291

View in Genome Browser
Species Human (GRCh38)
Location 22:37037791-37037813
Sequence CCCTCCAGGGCTGCACTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183297291_1183297305 21 Left 1183297291 22:37037791-37037813 CCTTCCAGTGCAGCCCTGGAGGG No data
Right 1183297305 22:37037835-37037857 GAGACAGAGCCTGGGAGCAGGGG No data
1183297291_1183297308 26 Left 1183297291 22:37037791-37037813 CCTTCCAGTGCAGCCCTGGAGGG No data
Right 1183297308 22:37037840-37037862 AGAGCCTGGGAGCAGGGGTGGGG No data
1183297291_1183297309 29 Left 1183297291 22:37037791-37037813 CCTTCCAGTGCAGCCCTGGAGGG No data
Right 1183297309 22:37037843-37037865 GCCTGGGAGCAGGGGTGGGGTGG No data
1183297291_1183297302 13 Left 1183297291 22:37037791-37037813 CCTTCCAGTGCAGCCCTGGAGGG No data
Right 1183297302 22:37037827-37037849 GAGAGCGGGAGACAGAGCCTGGG No data
1183297291_1183297301 12 Left 1183297291 22:37037791-37037813 CCTTCCAGTGCAGCCCTGGAGGG No data
Right 1183297301 22:37037826-37037848 GGAGAGCGGGAGACAGAGCCTGG No data
1183297291_1183297298 -9 Left 1183297291 22:37037791-37037813 CCTTCCAGTGCAGCCCTGGAGGG No data
Right 1183297298 22:37037805-37037827 CCTGGAGGGTGGAAACAGGAAGG No data
1183297291_1183297303 19 Left 1183297291 22:37037791-37037813 CCTTCCAGTGCAGCCCTGGAGGG No data
Right 1183297303 22:37037833-37037855 GGGAGACAGAGCCTGGGAGCAGG No data
1183297291_1183297299 -2 Left 1183297291 22:37037791-37037813 CCTTCCAGTGCAGCCCTGGAGGG No data
Right 1183297299 22:37037812-37037834 GGTGGAAACAGGAAGGAGAGCGG No data
1183297291_1183297311 30 Left 1183297291 22:37037791-37037813 CCTTCCAGTGCAGCCCTGGAGGG No data
Right 1183297311 22:37037844-37037866 CCTGGGAGCAGGGGTGGGGTGGG No data
1183297291_1183297304 20 Left 1183297291 22:37037791-37037813 CCTTCCAGTGCAGCCCTGGAGGG No data
Right 1183297304 22:37037834-37037856 GGAGACAGAGCCTGGGAGCAGGG No data
1183297291_1183297307 25 Left 1183297291 22:37037791-37037813 CCTTCCAGTGCAGCCCTGGAGGG No data
Right 1183297307 22:37037839-37037861 CAGAGCCTGGGAGCAGGGGTGGG No data
1183297291_1183297306 24 Left 1183297291 22:37037791-37037813 CCTTCCAGTGCAGCCCTGGAGGG No data
Right 1183297306 22:37037838-37037860 ACAGAGCCTGGGAGCAGGGGTGG No data
1183297291_1183297300 -1 Left 1183297291 22:37037791-37037813 CCTTCCAGTGCAGCCCTGGAGGG No data
Right 1183297300 22:37037813-37037835 GTGGAAACAGGAAGGAGAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183297291 Original CRISPR CCCTCCAGGGCTGCACTGGA AGG (reversed) Intergenic
No off target data available for this crispr