ID: 1183297962

View in Genome Browser
Species Human (GRCh38)
Location 22:37043283-37043305
Sequence CCCAGCAAGGAGCAGCTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183297962_1183297970 12 Left 1183297962 22:37043283-37043305 CCTGCCAGCTGCTCCTTGCTGGG No data
Right 1183297970 22:37043318-37043340 ATGTGCTGTGAGTCTTGTCAGGG No data
1183297962_1183297974 29 Left 1183297962 22:37043283-37043305 CCTGCCAGCTGCTCCTTGCTGGG No data
Right 1183297974 22:37043335-37043357 TCAGGGTGGGGCCTGCCTGCAGG No data
1183297962_1183297971 15 Left 1183297962 22:37043283-37043305 CCTGCCAGCTGCTCCTTGCTGGG No data
Right 1183297971 22:37043321-37043343 TGCTGTGAGTCTTGTCAGGGTGG No data
1183297962_1183297972 16 Left 1183297962 22:37043283-37043305 CCTGCCAGCTGCTCCTTGCTGGG No data
Right 1183297972 22:37043322-37043344 GCTGTGAGTCTTGTCAGGGTGGG No data
1183297962_1183297973 17 Left 1183297962 22:37043283-37043305 CCTGCCAGCTGCTCCTTGCTGGG No data
Right 1183297973 22:37043323-37043345 CTGTGAGTCTTGTCAGGGTGGGG No data
1183297962_1183297969 11 Left 1183297962 22:37043283-37043305 CCTGCCAGCTGCTCCTTGCTGGG No data
Right 1183297969 22:37043317-37043339 CATGTGCTGTGAGTCTTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183297962 Original CRISPR CCCAGCAAGGAGCAGCTGGC AGG (reversed) Intergenic
No off target data available for this crispr