ID: 1183299266

View in Genome Browser
Species Human (GRCh38)
Location 22:37050918-37050940
Sequence CGTCCTCCCTAAGAAGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183299266_1183299271 11 Left 1183299266 22:37050918-37050940 CCTCCTCCTTCTTAGGGAGGACG No data
Right 1183299271 22:37050952-37050974 AGAAAGGCCAAAAGCCAGAATGG No data
1183299266_1183299270 -5 Left 1183299266 22:37050918-37050940 CCTCCTCCTTCTTAGGGAGGACG No data
Right 1183299270 22:37050936-37050958 GGACGTGGAAAAACTGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183299266 Original CRISPR CGTCCTCCCTAAGAAGGAGG AGG (reversed) Intergenic
No off target data available for this crispr