ID: 1183301049

View in Genome Browser
Species Human (GRCh38)
Location 22:37059366-37059388
Sequence GCTCCTTGGACACCACACAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 1, 2: 3, 3: 16, 4: 151}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183301049_1183301052 -3 Left 1183301049 22:37059366-37059388 CCTGTGTGTGGTGTCCAAGGAGC 0: 1
1: 1
2: 3
3: 16
4: 151
Right 1183301052 22:37059386-37059408 AGCTCCACAGCACCCCAAACGGG 0: 1
1: 0
2: 0
3: 41
4: 927
1183301049_1183301051 -4 Left 1183301049 22:37059366-37059388 CCTGTGTGTGGTGTCCAAGGAGC 0: 1
1: 1
2: 3
3: 16
4: 151
Right 1183301051 22:37059385-37059407 GAGCTCCACAGCACCCCAAACGG 0: 1
1: 0
2: 1
3: 17
4: 148
1183301049_1183301057 28 Left 1183301049 22:37059366-37059388 CCTGTGTGTGGTGTCCAAGGAGC 0: 1
1: 1
2: 3
3: 16
4: 151
Right 1183301057 22:37059417-37059439 AGAGTCCAGCCGCAAAACCAAGG 0: 1
1: 0
2: 0
3: 9
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183301049 Original CRISPR GCTCCTTGGACACCACACAC AGG (reversed) Exonic
900616428 1:3567636-3567658 GCTCCTTGGCCATCACACCGTGG + Intronic
900972507 1:5999330-5999352 GCTCCTTGGCCACCAGTCCCTGG + Intronic
901088010 1:6623687-6623709 ACTTCTTAGACACCACCCACAGG - Exonic
901665745 1:10825175-10825197 GCTCCTGGGAATTCACACACTGG + Intergenic
903514493 1:23901519-23901541 GCTCCTCGGACAGCACCAACGGG - Intronic
905362804 1:37431926-37431948 GCCCCTTACACACCACACACAGG + Intergenic
906293285 1:44633609-44633631 GCTCCTTGCTCAGGACACACAGG - Intronic
906416492 1:45624071-45624093 GCTCCCTGGACAGCAACCACAGG + Intergenic
908052170 1:60245350-60245372 GCTCCTTTGACATCTCACAACGG + Intergenic
912856218 1:113170823-113170845 GCTTCCTGGAGACCACACAATGG + Intergenic
914850046 1:151307600-151307622 GGTCCGTGTACCCCACACACAGG - Exonic
915734782 1:158077884-158077906 TCTCCTGGGACACCACTGACAGG - Intronic
917491007 1:175498450-175498472 GCCCCTTGGTCACCACAAAGAGG + Intronic
917969369 1:180197207-180197229 GCTCCTTTGACACAAAAGACAGG + Exonic
920737494 1:208546441-208546463 GCTCCTAAGAGACCACATACAGG + Intergenic
1063149065 10:3320528-3320550 GCTCCTTGGACCCCACAGTCTGG - Intergenic
1064012101 10:11743069-11743091 GCTCCTTGGCCCTCACACAGAGG + Intronic
1064031574 10:11886269-11886291 TGGCTTTGGACACCACACACGGG - Intergenic
1065620790 10:27578825-27578847 GCTCCCTTGAAATCACACACAGG - Intergenic
1065979533 10:30878524-30878546 TCTTCTTGGACACCACACAAGGG + Intronic
1070384339 10:75911097-75911119 TCTCCTAGGACACCAGACATAGG - Intronic
1076873024 10:133202839-133202861 GCATCTCGGACACCCCACACAGG + Intronic
1077187853 11:1243455-1243477 ACACCATGGCCACCACACACGGG + Exonic
1080318808 11:30981833-30981855 GCTGCATGGATACCACACGCTGG + Intronic
1083487873 11:62994976-62994998 GCACCTTTGCCACCACACCCTGG - Intronic
1084068920 11:66721280-66721302 GGTCCCTGGACACCCCTCACTGG - Intronic
1084770474 11:71339808-71339830 GCTCCAGAGAGACCACACACGGG - Intergenic
1085401436 11:76238203-76238225 GTTCCTTGGACACTCCAGACAGG + Intergenic
1085788913 11:79478905-79478927 CCTCTTTGGCCAACACACACTGG + Intergenic
1087757963 11:102074263-102074285 GCTGCCTGGAGACCACACAATGG - Intronic
1088689286 11:112311517-112311539 TCTCCTTGGACACTTCACTCTGG + Intergenic
1089818533 11:121199682-121199704 GCCCCTAGGAATCCACACACAGG - Intergenic
1090468338 11:126955543-126955565 TCTCCCTGGCCAACACACACTGG - Intronic
1091912106 12:4240907-4240929 GCTCTCTGGAGACCACACAGAGG - Intergenic
1092442338 12:8517472-8517494 CCTTCCTGGACAGCACACACCGG - Intronic
1093592316 12:20917568-20917590 TCTTCTTGGACACCAGACAAGGG - Intergenic
1093852213 12:24054428-24054450 GTTCCTTGGGCACTACACATGGG + Intergenic
1095209657 12:39477364-39477386 GCACCTTTGACACCAGACTCAGG - Intergenic
1096808535 12:54155397-54155419 GGTCCTTGGAGATCACACAGTGG + Intergenic
1100430925 12:94531347-94531369 ACTCCTTAGGCACCAGACACTGG - Intergenic
1101327722 12:103731196-103731218 CCACCTTGGACACTAGACACTGG + Intronic
1102752063 12:115303776-115303798 GCTTCTCGGACAGCACTCACTGG - Intergenic
1103062813 12:117872762-117872784 GGTCCTTGGACAATAAACACAGG + Intronic
1103945399 12:124523352-124523374 GCTCCTGGGAACCCACACCCCGG + Intronic
1105450476 13:20494864-20494886 CCTCCCTGGGCAGCACACACAGG + Intronic
1105844377 13:24281708-24281730 GCTCAGTGGGCACCACTCACAGG + Intronic
1106651905 13:31700403-31700425 GCTGTTAGAACACCACACACTGG + Intergenic
1112114276 13:96335235-96335257 GTTCCTGGGACACCTCACATTGG - Intronic
1112892605 13:104256844-104256866 GCTCATTGGATGTCACACACAGG - Intergenic
1113198783 13:107840783-107840805 GCTCCTTCCACAACACACCCTGG + Intronic
1113610793 13:111643644-111643666 GCTCCTTGGAAATCACCCACTGG - Intronic
1113762321 13:112858090-112858112 GCTTTCTGCACACCACACACAGG - Intronic
1122775621 14:104115864-104115886 GCCCCTCGGACTCCACACCCAGG + Intergenic
1122993629 14:105250602-105250624 GCTCCTCGGACAGCACCAACGGG + Exonic
1130447943 15:84021486-84021508 GCCCATTGGCCATCACACACTGG - Exonic
1131271436 15:90949882-90949904 GCTCCTTGGCCCCTCCACACTGG + Intronic
1132973960 16:2702406-2702428 GCTCCTTGGACACCACACAGAGG - Exonic
1133970044 16:10560893-10560915 GGGCCTTGGAGACCACACAAAGG + Intronic
1137912014 16:52387306-52387328 TCTCCTTGGAAACCACTGACAGG + Intergenic
1138451564 16:57096279-57096301 GCTAGTTGAGCACCACACACTGG - Intronic
1142127952 16:88419531-88419553 CCACCCTGGACACCACACAAGGG - Intergenic
1143401274 17:6645431-6645453 GCTCCTTGGAAACCACAGTCTGG - Intronic
1143967611 17:10767969-10767991 GCTCCTTCCACACCACACCCTGG - Intergenic
1144825578 17:18103951-18103973 GGTCTCTGGGCACCACACACCGG - Intronic
1144862674 17:18315330-18315352 GCTCCTAGGACGCCACAACCCGG - Exonic
1150764884 17:67994744-67994766 GCTTCTTGGACACCACTTACTGG + Intergenic
1151975382 17:77481184-77481206 GCTGTTAAGACACCACACACGGG - Intronic
1152471453 17:80492148-80492170 GCTCCTGGGAACCCAGACACAGG + Intergenic
1154355831 18:13622587-13622609 GCTCTGTGGACACCAGACAAAGG - Intronic
1155109723 18:22702248-22702270 GGTCCTAGGACACAAAACACTGG - Intergenic
1155491625 18:26406375-26406397 GGTCCCTGGACACCACGCAGGGG + Intergenic
1156042297 18:32836120-32836142 CCTCACTGGACAACACACACAGG - Intergenic
1161400142 19:4063702-4063724 GCCCCTGGGCCACCACACAGTGG + Intronic
1161411657 19:4121409-4121431 GCTTCAGGGACTCCACACACTGG + Intronic
1161595226 19:5147907-5147929 TCTCCTTGGCCACCACACAGCGG - Intronic
1161901510 19:7122959-7122981 GGCCCTTGGACACCACTCCCAGG + Exonic
1163861585 19:19745869-19745891 GCTCCATGGGCTGCACACACAGG + Intergenic
1165566056 19:36729189-36729211 GCTACTTGGATACCCCCCACTGG - Intronic
1165857500 19:38888782-38888804 GCTCCTTCCACATCACACATGGG + Intronic
1166437861 19:42784997-42785019 GCTCCTGGAACACAACACAGAGG - Intronic
1168184425 19:54690038-54690060 CCTCCTTGGTAATCACACACAGG - Intronic
925437841 2:3856758-3856780 GCTCCCTGGACAGCCTACACAGG + Intergenic
926426432 2:12742774-12742796 GCTTTGTGGTCACCACACACCGG + Intergenic
930538951 2:52680650-52680672 GTTCCTTGGAAACAACACAAAGG + Intergenic
932572835 2:72946894-72946916 GCTCCTTGGACTGGAGACACAGG + Intronic
933567049 2:83962859-83962881 CCTCCTTGGACCTCACACCCTGG + Intergenic
934950903 2:98574719-98574741 TCTCCTTGGAATACACACACAGG + Intronic
935578278 2:104733690-104733712 GCTCCTTGGCCAGGTCACACGGG - Intergenic
936066620 2:109337399-109337421 GCGCTAAGGACACCACACACAGG - Intronic
938717271 2:134032092-134032114 TCTCCTGGGAAGCCACACACTGG + Intergenic
940791523 2:158034363-158034385 GCTCCTTCGACCTCACACATAGG + Intronic
942450348 2:176105104-176105126 GCTCCCTGGACGCTGCACACTGG - Intronic
944573808 2:201071758-201071780 AATCCTTAGACACCGCACACAGG - Exonic
946149435 2:217754185-217754207 CCCCCTTGGACCCCACAGACTGG + Intronic
948465926 2:238151599-238151621 GCTCCGCGTCCACCACACACGGG + Exonic
948978388 2:241478891-241478913 GTTTCTTGGACACCACATAGAGG - Intronic
1172330666 20:34074213-34074235 GCTGCTTGGGCACCTCACAGAGG - Intronic
1172619235 20:36308224-36308246 TCGCCATGGACACCACACACGGG - Intronic
1178367180 21:31997775-31997797 GGTCCTTGGACAGCCCACAGTGG - Intronic
1180142405 21:45900409-45900431 GCTCCATGCCCACCACACCCTGG - Intronic
1180754035 22:18147912-18147934 CCTCCCTGGACACCACACACTGG + Intergenic
1181173434 22:21022955-21022977 TCCCATTGAACACCACACACTGG - Exonic
1181367671 22:22391159-22391181 GCTCCTTGGTCCCTACACAGAGG + Intergenic
1183301049 22:37059366-37059388 GCTCCTTGGACACCACACACAGG - Exonic
1184351328 22:43945927-43945949 GCTACCTGGACACCTCCCACTGG - Intronic
1185067207 22:48638496-48638518 AGCCCTGGGACACCACACACAGG + Intronic
1185067220 22:48638535-48638557 AGCCCTGGGACACCACACACAGG + Intronic
1185067277 22:48638736-48638758 AGCCCTGGGACACCACACACAGG + Intronic
1185067353 22:48638953-48638975 AGCCCTGGGACACCACACACAGG + Intronic
949883643 3:8679029-8679051 GCTCTTAGGACACCAAACGCAGG + Intronic
950271682 3:11620934-11620956 GCTCTCTGGACACCCCACCCAGG - Intronic
950777312 3:15361932-15361954 GCTCCTCTGAGCCCACACACAGG + Intergenic
953567252 3:44043340-44043362 GCTGCTTTGACATCAAACACTGG - Intergenic
954758971 3:52860531-52860553 GCTGCCTGGCCACCACACACAGG - Intronic
960949015 3:122987022-122987044 GCTCCTTGGAGACCAGAGAAAGG + Intronic
961108876 3:124266676-124266698 GCCTATTTGACACCACACACAGG - Intronic
966269189 3:178084138-178084160 GCTCCCTGGATATCACACTCAGG + Intergenic
968027104 3:195451583-195451605 GCTCCTTGGAGTCCACACAGGGG - Intergenic
968152102 3:196345128-196345150 GCTCCCTTGACACCCCACTCTGG + Intergenic
968957895 4:3728365-3728387 GACGCTTGGCCACCACACACGGG - Intergenic
979738902 4:124125714-124125736 GCTCCCTGGGCACCACACACTGG - Intergenic
982085831 4:151835305-151835327 CCACCATGGCCACCACACACAGG - Intergenic
983815881 4:172126679-172126701 GCTGCTTGGAGACCACACAAAGG + Intronic
986707853 5:10466190-10466212 GCTCCTTGGGCCCCCCAGACAGG - Intronic
990941024 5:61203306-61203328 GCTTCTTGTACAGCACCCACAGG + Intergenic
991482918 5:67102843-67102865 GCCACTTGTGCACCACACACGGG + Intronic
997250941 5:132388064-132388086 GCTGCTGGGCCACCACTCACTGG - Intronic
997622332 5:135306928-135306950 TCTCTTTGGACATCACACTCTGG + Intronic
1002628258 5:180548583-180548605 ACTCCTTGGACAGCACTTACAGG - Intronic
1002797410 6:485683-485705 GCTCCTTGGTCACCAGGCAATGG - Exonic
1002866779 6:1128947-1128969 GCTCATTTGACATCACACAGCGG + Intergenic
1003766939 6:9248347-9248369 GCTCCAGGGTCACCACACTCTGG - Intergenic
1007940143 6:45773014-45773036 GCTCCTTTGAAACCAGACACTGG - Intergenic
1008421991 6:51311718-51311740 GCTACTTGGACACCACAGTGTGG - Intergenic
1008753370 6:54763888-54763910 GATCCTGGGCAACCACACACTGG - Intergenic
1012263034 6:97110568-97110590 GCTCCTTGGCAAACACAAACTGG - Intronic
1015022474 6:128492982-128493004 GCACATGGGACACCACACTCTGG - Intronic
1015599057 6:134894647-134894669 TCTCCCTGGAAACCACTCACTGG + Intergenic
1015675290 6:135739492-135739514 ACGCCATGTACACCACACACCGG - Intergenic
1017010248 6:150058394-150058416 CCTCCTTGGACATCAGACTCCGG - Intergenic
1017048819 6:150371746-150371768 GATCTGTGGACACCACACTCAGG - Intronic
1018241019 6:161774677-161774699 GCCCCTTGGCCAACCCACACTGG + Intronic
1034776053 7:153827903-153827925 GCTCCTTGGACAACCCCCAGTGG - Intergenic
1034996929 7:155583614-155583636 GCTCCTTGGCCACCCCACCTGGG + Intergenic
1035056394 7:156039390-156039412 GCTCCCAGGGCACCACTCACTGG + Intergenic
1035808603 8:2472871-2472893 GCACCTTGGCCCACACACACTGG + Intergenic
1037877041 8:22553462-22553484 CCCCCTTGGACACCCCAAACTGG + Intronic
1037935834 8:22914512-22914534 ACTCCTTGGTCCCCTCACACGGG + Intronic
1038101975 8:24387912-24387934 GCTCTTTGGACACCAGAGCCAGG - Intronic
1038522791 8:28247751-28247773 GCTCCTAGGACACCTCCCACAGG + Intergenic
1040984649 8:53280357-53280379 GCTCCTGGGAAACCACAAAGAGG + Intergenic
1041466425 8:58162124-58162146 GCTCCCTGCACACCAGTCACAGG + Intronic
1043064063 8:75543690-75543712 GCTTCTTGGAGACCCCACACTGG - Intronic
1043101554 8:76053657-76053679 GCGCCTTGGACAAAACCCACTGG - Intergenic
1043196544 8:77300015-77300037 GCACCATGGATACCACACAAAGG - Intergenic
1044118622 8:88366164-88366186 CCACCTTGAACATCACACACCGG - Intergenic
1047494216 8:125398169-125398191 GGGCCTTGGACACCACACCAAGG - Intergenic
1048438894 8:134445241-134445263 GCTCCTTGGACACTAAAAATTGG - Intergenic
1048500176 8:134968294-134968316 GCTCCTTGGAGGCCACTCATAGG + Intergenic
1048967531 8:139625308-139625330 GCTCCCAGGACAGCACCCACAGG + Intronic
1050020264 9:1276599-1276621 ACTTCTTGTTCACCACACACAGG - Intergenic
1050042225 9:1508188-1508210 GCTGCTTGTAAACCACACAGTGG - Intergenic
1056679246 9:88702789-88702811 GCTCCCTGGGCACCACACACTGG + Intergenic
1058226422 9:102370236-102370258 TCTCCATGGACACCACAGATGGG - Intergenic
1058678933 9:107424966-107424988 GCTCCTAGGACCACCCACACTGG - Intergenic
1062149877 9:135012417-135012439 CCTCCCTGGGCCCCACACACAGG - Intergenic
1062676061 9:137744735-137744757 GCACTGTGGACACCACACATGGG + Intronic
1190284203 X:48951311-48951333 GCTCCATGGACAAAACACAGGGG + Intronic
1190460256 X:50666243-50666265 GATCCTGGGATACAACACACAGG + Intronic
1197673249 X:129302107-129302129 GCTTCCTGGACACCATACTCTGG + Intergenic
1200424334 Y:3005155-3005177 TCTTCTTGCACCCCACACACTGG - Intergenic
1200870509 Y:8093210-8093232 TCTGCCTGGACACCACACACAGG - Intergenic