ID: 1183301055

View in Genome Browser
Species Human (GRCh38)
Location 22:37059399-37059421
Sequence ACTCTGAGCTCAGCCCGTTT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 105}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183301055_1183301057 -5 Left 1183301055 22:37059399-37059421 CCCAAACGGGCTGAGCTCAGAGT 0: 1
1: 0
2: 0
3: 4
4: 105
Right 1183301057 22:37059417-37059439 AGAGTCCAGCCGCAAAACCAAGG 0: 1
1: 0
2: 0
3: 9
4: 141
1183301055_1183301063 24 Left 1183301055 22:37059399-37059421 CCCAAACGGGCTGAGCTCAGAGT 0: 1
1: 0
2: 0
3: 4
4: 105
Right 1183301063 22:37059446-37059468 CACCCGCCTCAGCCTGTGTCCGG 0: 1
1: 0
2: 1
3: 19
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183301055 Original CRISPR ACTCTGAGCTCAGCCCGTTT GGG (reversed) Exonic
901194942 1:7435252-7435274 ACTGTGAGCTCAGCAGGTCTAGG - Intronic
903873796 1:26457992-26458014 ACTCTGGCCCCAGCCTGTTTGGG - Intronic
905450385 1:38052261-38052283 CCTCTAAGCTCAGCCCCTTCAGG + Intergenic
906069532 1:43007142-43007164 ACTTGGAGATCAGCCCGTCTAGG + Intergenic
906648517 1:47493320-47493342 GCTCGGAGCTCACCCCTTTTGGG - Intergenic
908479664 1:64526087-64526109 AGTTTGAGCTCAACCCCTTTTGG + Intronic
912489127 1:110051893-110051915 ACTCTGCACTCAGCCAGATTTGG + Intronic
916904771 1:169270876-169270898 ACTCTGAAATCAGGCTGTTTAGG - Intronic
917443592 1:175088065-175088087 ACTCTGAACCCAGTCCTTTTGGG + Intronic
918561028 1:185867781-185867803 CCACTGCGCTCAGCCTGTTTTGG - Intronic
920028403 1:203018849-203018871 ACACTAGGCTCAGCCCCTTTTGG - Intronic
1075428229 10:122358928-122358950 ACTCTGAGTTTATCCCATTTGGG - Intergenic
1076684777 10:132193423-132193445 CCTCTGAGCTCAGCCCAGCTGGG + Intronic
1077050848 11:566136-566158 ACTCTGGGCTTAGCCCCTTCTGG - Intergenic
1077443871 11:2581265-2581287 ACCCTGGGCTGAGCCCCTTTGGG + Intronic
1079309075 11:19348380-19348402 ATTCTGAACTCAGCCTGCTTGGG + Intergenic
1081594332 11:44448801-44448823 AGCCTGAGCTCAGCACATTTAGG - Intergenic
1083207617 11:61161862-61161884 AGTCTGAGCTCAGCCCATCTGGG - Intergenic
1083488433 11:62997853-62997875 GCTATGTGCACAGCCCGTTTTGG - Intronic
1085339025 11:75719348-75719370 AATCAGAGCTCAGCAGGTTTGGG + Intronic
1088756645 11:112890518-112890540 ACTCTGAAGTCGGCCCTTTTTGG - Intergenic
1097629296 12:62040253-62040275 GTTCTGACCTCAGCCCCTTTTGG - Intronic
1099551420 12:84049005-84049027 ACTCTAAGCTCTGTCTGTTTAGG + Intergenic
1102788559 12:115624156-115624178 ATGCTGGGCCCAGCCCGTTTGGG + Intergenic
1105904125 13:24787637-24787659 AATCTGAGCTCAGACTCTTTAGG - Intronic
1110356779 13:74575958-74575980 ACTCCCAGCTTAGCCCGATTTGG - Intergenic
1111925865 13:94462847-94462869 ATGCTGAGCTAAGCCAGTTTTGG + Intronic
1116363381 14:44029478-44029500 TCTCTGAGCTCTGTCCCTTTGGG + Intergenic
1118964173 14:70563967-70563989 GCTCTGAACTAAGCCAGTTTGGG - Intergenic
1122313150 14:100810058-100810080 ACTCTGAGGTCATCCCATGTGGG + Intergenic
1122558209 14:102592719-102592741 GCTCCGCGCTCTGCCCGTTTGGG + Exonic
1125593860 15:40872375-40872397 ACTCCTGGCTCAGCCAGTTTGGG + Exonic
1125921751 15:43529216-43529238 ACTCTGAGCTGAGCCCCTCGGGG - Exonic
1128073322 15:64810771-64810793 ACTCTGGGCTCAGCCCCCTCAGG + Intergenic
1133874667 16:9722610-9722632 ACTCTGGGCTCAGCCCTCCTGGG - Intergenic
1134900567 16:17934242-17934264 TCTCTGAGCCCATCCAGTTTAGG + Intergenic
1139953359 16:70682257-70682279 ACCCTGAGCTGTGCCCATTTGGG - Intronic
1140979445 16:80092824-80092846 ACTCATGACTCAGCCCGTTTAGG + Intergenic
1142195278 16:88736712-88736734 TCCCTGGGCTCAGCCCGCTTGGG + Exonic
1143265473 17:5633825-5633847 ACTCTAAGCACAGCCCTTCTGGG + Intergenic
1147463381 17:40590442-40590464 ACTCTGAGTGTAGCCTGTTTGGG - Intergenic
1150848052 17:68679194-68679216 CCTCTGGGATCTGCCCGTTTCGG + Intergenic
1157271538 18:46280075-46280097 AGTTTGAGCTAAGCCTGTTTCGG - Intergenic
1159740399 18:72160939-72160961 ACTCTAAGCTCACACCGGTTTGG - Intergenic
1160671624 19:367419-367441 ACCCTTTGCTCAGCCCTTTTGGG - Intronic
1161428391 19:4216961-4216983 TCTCTGACCTCAGCCCCTGTGGG - Exonic
1163536638 19:17880754-17880776 ACTCTGAGCCCTGTCCGTCTTGG + Intronic
1165362723 19:35346618-35346640 ACTCAGAGCTGATCCAGTTTGGG + Exonic
931641297 2:64383083-64383105 ACTCTGAGGTCTGGCCATTTTGG + Intergenic
932494108 2:72138131-72138153 CCTCTGAGCCCAGCCCCTTGGGG - Intronic
935460373 2:103324821-103324843 TTTCTGAGCTGAGGCCGTTTTGG + Intergenic
946119247 2:217494879-217494901 GCACAGTGCTCAGCCCGTTTTGG - Intronic
948583986 2:239007153-239007175 ACTCAGAGCTCAGCCCGAACTGG + Intergenic
1175228690 20:57460230-57460252 ACTCTGAGCTCAGGGCCTGTGGG + Intergenic
1175708904 20:61203469-61203491 ACTCTGAGCAGTGCCCGTGTGGG - Intergenic
1176202140 20:63865875-63865897 GCTCGGAGCTCAGCCTGCTTAGG + Intronic
1176511169 21:7749403-7749425 CCACTGTGCTCAGGCCGTTTTGG + Intronic
1177450514 21:21259261-21259283 TCTCTGTGCTGAGCCCATTTTGG + Intronic
1178645283 21:34379932-34379954 CCACTGTGCTCAGGCCGTTTTGG + Intronic
1183157282 22:36085180-36085202 ACCCTGTGCTCAGCCCGTGGAGG + Intergenic
1183301055 22:37059399-37059421 ACTCTGAGCTCAGCCCGTTTGGG - Exonic
1183757708 22:39785447-39785469 CCTCTGAGCTCAGCTCCTCTAGG + Intronic
1184891614 22:47382820-47382842 GCCCTGAGCTCTGCCCATTTGGG - Intergenic
951940826 3:28076938-28076960 CCTCTGAGTTCAGTCCGTGTTGG + Intergenic
961145174 3:124587077-124587099 ACTCTCCCCTCAGCCCTTTTGGG - Intronic
964517889 3:157532454-157532476 TCTCTGAGCTCAGCCTGGCTGGG - Intronic
967259130 3:187624716-187624738 CCTCTGAGCACAGCCAGTCTGGG - Intergenic
967887408 3:194342436-194342458 ACACTCAGCTCTGCCAGTTTAGG - Exonic
968835632 4:2962798-2962820 ACTTTGAGCTCTGCAGGTTTGGG - Intronic
970003471 4:11387744-11387766 ACTCTGAACTCTGTCCGTTTGGG + Intergenic
974474440 4:62361536-62361558 AGTCTGAGCTCAGACTCTTTGGG + Intergenic
974877229 4:67715070-67715092 ACCCTGAGCTCAGGCCCTTGGGG + Intergenic
975376209 4:73649408-73649430 ACCCTCAGCTCAGCCAATTTGGG + Intergenic
982836910 4:160130744-160130766 AGTCTGAGCTGATCCCATTTGGG - Intergenic
985640960 5:1063333-1063355 CCTCTGAGCACCTCCCGTTTTGG - Intronic
986905260 5:12488098-12488120 ACTCTGAGCTGATCCTGTTGGGG - Intergenic
987520156 5:18971561-18971583 AATCTTAGCTCAGACTGTTTGGG + Intergenic
989275057 5:39579202-39579224 CCTCTGTGGTCAGCCCTTTTTGG + Intergenic
989698556 5:44234026-44234048 ACTCTGAGCCTAGCCAGCTTTGG + Intergenic
993504308 5:88692336-88692358 ACTGTGAGCACAGCCCGCTTGGG + Intergenic
995087738 5:108134569-108134591 ACACTGAGCTGGGCCCATTTTGG - Intronic
996250215 5:121319574-121319596 ACTCTGTGCTCAGCCCCTTGTGG - Intergenic
1000519839 5:162281857-162281879 CCTCTGAGCTCACCCTGATTTGG + Intergenic
1001821032 5:174710438-174710460 ACTCTGAGGACAGAACGTTTGGG + Intergenic
1002473686 5:179452260-179452282 ACTCTGGGCTCACCCAGGTTGGG + Intergenic
1002712555 5:181204176-181204198 ACTTTGAGCAGAGCCCGCTTCGG + Intronic
1007520579 6:42449313-42449335 TCTCTGGGCTCCGCCCTTTTAGG - Intronic
1010096185 6:72049050-72049072 GCTCTGAGCTCAGCCCCTGGTGG - Intronic
1017181973 6:151563041-151563063 ACTCTCCCCTCAGCCCATTTTGG - Intronic
1018066516 6:160128386-160128408 ACTCTGAACTCAGCCAGCCTGGG - Intronic
1019922128 7:4169660-4169682 ACACTGAGCTCCGCCCCTTGGGG - Intronic
1019931403 7:4225740-4225762 AGTCTGAGCTCAGCAGGGTTGGG + Intronic
1020334485 7:7052171-7052193 TCTCTGAACTCTGCCCTTTTGGG - Intergenic
1020870561 7:13623907-13623929 AATCTGTGCTCAGCCTTTTTTGG - Intergenic
1024657594 7:51464907-51464929 GCTCTGAGCTCTGCTGGTTTAGG - Intergenic
1026846933 7:73703847-73703869 ACACTGAGCCCAGCCCTCTTCGG + Intronic
1027622977 7:80515277-80515299 ACACTGATCACAGCCTGTTTTGG - Intronic
1035238939 7:157517608-157517630 TCTCTGAGCCCAGCCCTGTTGGG + Intergenic
1035688385 8:1542783-1542805 ACTCTGTGTTCAGCCTTTTTAGG + Intronic
1037562511 8:20087710-20087732 CCACTGAGCTCAGCTCCTTTTGG - Intergenic
1044217943 8:89634920-89634942 ACTCTGAGGCCAGCCTGTCTGGG - Intergenic
1048328813 8:133458455-133458477 ACCCTGAGCTCAGGCCCTTGGGG + Exonic
1049233848 8:141498189-141498211 CATCTGAGCTCAGTACGTTTGGG + Intergenic
1050227664 9:3478915-3478937 ACTCTGAACTCAGCTCAGTTGGG - Intronic
1052243085 9:26298453-26298475 ACTCTGACCCCAGCTTGTTTTGG + Intergenic
1053290942 9:36879355-36879377 TCTCTGAACTCAGCCTCTTTGGG + Intronic
1056629866 9:88284291-88284313 ACTCTGAGGTCAGCATCTTTAGG - Intergenic
1060729503 9:126028284-126028306 ACACTGAGCTCAGCCTTTGTAGG + Intergenic
1197713730 X:129690545-129690567 CCTTTGAGCTCTGCGCGTTTGGG - Intergenic
1198430634 X:136563330-136563352 ACTCTTAGATTAGCCCTTTTGGG + Intergenic